ID: 917211225

View in Genome Browser
Species Human (GRCh38)
Location 1:172633864-172633886
Sequence AAAAGACATTCTTATCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917211225_917211232 25 Left 917211225 1:172633864-172633886 CCAGAGTGATAAGAATGTCTTTT No data
Right 917211232 1:172633912-172633934 CGGGACACTAAGGTAGCTTCAGG No data
917211225_917211226 -4 Left 917211225 1:172633864-172633886 CCAGAGTGATAAGAATGTCTTTT No data
Right 917211226 1:172633883-172633905 TTTTGTATGCTAATGATGACTGG No data
917211225_917211230 15 Left 917211225 1:172633864-172633886 CCAGAGTGATAAGAATGTCTTTT No data
Right 917211230 1:172633902-172633924 CTGGTGGCTCCGGGACACTAAGG No data
917211225_917211229 6 Left 917211225 1:172633864-172633886 CCAGAGTGATAAGAATGTCTTTT No data
Right 917211229 1:172633893-172633915 TAATGATGACTGGTGGCTCCGGG No data
917211225_917211228 5 Left 917211225 1:172633864-172633886 CCAGAGTGATAAGAATGTCTTTT No data
Right 917211228 1:172633892-172633914 CTAATGATGACTGGTGGCTCCGG No data
917211225_917211227 -1 Left 917211225 1:172633864-172633886 CCAGAGTGATAAGAATGTCTTTT No data
Right 917211227 1:172633886-172633908 TGTATGCTAATGATGACTGGTGG No data
917211225_917211233 29 Left 917211225 1:172633864-172633886 CCAGAGTGATAAGAATGTCTTTT No data
Right 917211233 1:172633916-172633938 ACACTAAGGTAGCTTCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917211225 Original CRISPR AAAAGACATTCTTATCACTC TGG (reversed) Intergenic