ID: 917211226

View in Genome Browser
Species Human (GRCh38)
Location 1:172633883-172633905
Sequence TTTTGTATGCTAATGATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917211221_917211226 21 Left 917211221 1:172633839-172633861 CCAGCTCCTATAACCCTTGGAAT No data
Right 917211226 1:172633883-172633905 TTTTGTATGCTAATGATGACTGG No data
917211223_917211226 8 Left 917211223 1:172633852-172633874 CCCTTGGAATATCCAGAGTGATA No data
Right 917211226 1:172633883-172633905 TTTTGTATGCTAATGATGACTGG No data
917211219_917211226 28 Left 917211219 1:172633832-172633854 CCTGGCACCAGCTCCTATAACCC No data
Right 917211226 1:172633883-172633905 TTTTGTATGCTAATGATGACTGG No data
917211222_917211226 15 Left 917211222 1:172633845-172633867 CCTATAACCCTTGGAATATCCAG No data
Right 917211226 1:172633883-172633905 TTTTGTATGCTAATGATGACTGG No data
917211224_917211226 7 Left 917211224 1:172633853-172633875 CCTTGGAATATCCAGAGTGATAA No data
Right 917211226 1:172633883-172633905 TTTTGTATGCTAATGATGACTGG No data
917211225_917211226 -4 Left 917211225 1:172633864-172633886 CCAGAGTGATAAGAATGTCTTTT No data
Right 917211226 1:172633883-172633905 TTTTGTATGCTAATGATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917211226 Original CRISPR TTTTGTATGCTAATGATGAC TGG Intergenic
No off target data available for this crispr