ID: 917211229

View in Genome Browser
Species Human (GRCh38)
Location 1:172633893-172633915
Sequence TAATGATGACTGGTGGCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917211224_917211229 17 Left 917211224 1:172633853-172633875 CCTTGGAATATCCAGAGTGATAA No data
Right 917211229 1:172633893-172633915 TAATGATGACTGGTGGCTCCGGG No data
917211222_917211229 25 Left 917211222 1:172633845-172633867 CCTATAACCCTTGGAATATCCAG No data
Right 917211229 1:172633893-172633915 TAATGATGACTGGTGGCTCCGGG No data
917211225_917211229 6 Left 917211225 1:172633864-172633886 CCAGAGTGATAAGAATGTCTTTT No data
Right 917211229 1:172633893-172633915 TAATGATGACTGGTGGCTCCGGG No data
917211223_917211229 18 Left 917211223 1:172633852-172633874 CCCTTGGAATATCCAGAGTGATA No data
Right 917211229 1:172633893-172633915 TAATGATGACTGGTGGCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917211229 Original CRISPR TAATGATGACTGGTGGCTCC GGG Intergenic
No off target data available for this crispr