ID: 917211230

View in Genome Browser
Species Human (GRCh38)
Location 1:172633902-172633924
Sequence CTGGTGGCTCCGGGACACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917211223_917211230 27 Left 917211223 1:172633852-172633874 CCCTTGGAATATCCAGAGTGATA No data
Right 917211230 1:172633902-172633924 CTGGTGGCTCCGGGACACTAAGG No data
917211224_917211230 26 Left 917211224 1:172633853-172633875 CCTTGGAATATCCAGAGTGATAA No data
Right 917211230 1:172633902-172633924 CTGGTGGCTCCGGGACACTAAGG No data
917211225_917211230 15 Left 917211225 1:172633864-172633886 CCAGAGTGATAAGAATGTCTTTT No data
Right 917211230 1:172633902-172633924 CTGGTGGCTCCGGGACACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917211230 Original CRISPR CTGGTGGCTCCGGGACACTA AGG Intergenic
No off target data available for this crispr