ID: 917215227

View in Genome Browser
Species Human (GRCh38)
Location 1:172671294-172671316
Sequence GAACCCTCCTCCACAAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917215227_917215230 25 Left 917215227 1:172671294-172671316 CCATTCTTTGTGGAGGAGGGTTC No data
Right 917215230 1:172671342-172671364 TATAGTCATTGACAGTACCAGGG No data
917215227_917215229 24 Left 917215227 1:172671294-172671316 CCATTCTTTGTGGAGGAGGGTTC No data
Right 917215229 1:172671341-172671363 ATATAGTCATTGACAGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917215227 Original CRISPR GAACCCTCCTCCACAAAGAA TGG (reversed) Intergenic
No off target data available for this crispr