ID: 917215230

View in Genome Browser
Species Human (GRCh38)
Location 1:172671342-172671364
Sequence TATAGTCATTGACAGTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917215226_917215230 26 Left 917215226 1:172671293-172671315 CCCATTCTTTGTGGAGGAGGGTT No data
Right 917215230 1:172671342-172671364 TATAGTCATTGACAGTACCAGGG No data
917215227_917215230 25 Left 917215227 1:172671294-172671316 CCATTCTTTGTGGAGGAGGGTTC No data
Right 917215230 1:172671342-172671364 TATAGTCATTGACAGTACCAGGG No data
917215228_917215230 -8 Left 917215228 1:172671327-172671349 CCTATTTAGAAATAATATAGTCA No data
Right 917215230 1:172671342-172671364 TATAGTCATTGACAGTACCAGGG No data
917215225_917215230 27 Left 917215225 1:172671292-172671314 CCCCATTCTTTGTGGAGGAGGGT No data
Right 917215230 1:172671342-172671364 TATAGTCATTGACAGTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917215230 Original CRISPR TATAGTCATTGACAGTACCA GGG Intergenic