ID: 917215567

View in Genome Browser
Species Human (GRCh38)
Location 1:172674856-172674878
Sequence TGGCAAGCAGCACTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917215567_917215574 -1 Left 917215567 1:172674856-172674878 CCCTCCTCCAGTGCTGCTTGCCA No data
Right 917215574 1:172674878-172674900 ACAGAGGGAATAAAACTTCTTGG No data
917215567_917215578 30 Left 917215567 1:172674856-172674878 CCCTCCTCCAGTGCTGCTTGCCA No data
Right 917215578 1:172674909-172674931 TTGCAGCCCTGGCTTTTGGTGGG No data
917215567_917215576 26 Left 917215567 1:172674856-172674878 CCCTCCTCCAGTGCTGCTTGCCA No data
Right 917215576 1:172674905-172674927 TGTGTTGCAGCCCTGGCTTTTGG No data
917215567_917215577 29 Left 917215567 1:172674856-172674878 CCCTCCTCCAGTGCTGCTTGCCA No data
Right 917215577 1:172674908-172674930 GTTGCAGCCCTGGCTTTTGGTGG No data
917215567_917215575 19 Left 917215567 1:172674856-172674878 CCCTCCTCCAGTGCTGCTTGCCA No data
Right 917215575 1:172674898-172674920 TGGTTCTTGTGTTGCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917215567 Original CRISPR TGGCAAGCAGCACTGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr