ID: 917217211

View in Genome Browser
Species Human (GRCh38)
Location 1:172690877-172690899
Sequence GGCAGCTCTTGGTCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917217211_917217217 16 Left 917217211 1:172690877-172690899 CCAGTAACAGACCAAGAGCTGCC No data
Right 917217217 1:172690916-172690938 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
917217211_917217215 11 Left 917217211 1:172690877-172690899 CCAGTAACAGACCAAGAGCTGCC No data
Right 917217215 1:172690911-172690933 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247
917217211_917217216 15 Left 917217211 1:172690877-172690899 CCAGTAACAGACCAAGAGCTGCC No data
Right 917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917217211 Original CRISPR GGCAGCTCTTGGTCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr