ID: 917217225

View in Genome Browser
Species Human (GRCh38)
Location 1:172690977-172690999
Sequence AACCTCTGGCAGGCTTCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917217225_917217232 22 Left 917217225 1:172690977-172690999 CCTATGGAAGCCTGCCAGAGGTT No data
Right 917217232 1:172691022-172691044 ACTGAAACCTCAAGCACCATTGG 0: 7
1: 160
2: 183
3: 180
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917217225 Original CRISPR AACCTCTGGCAGGCTTCCAT AGG (reversed) Intergenic
No off target data available for this crispr