ID: 917219749

View in Genome Browser
Species Human (GRCh38)
Location 1:172716344-172716366
Sequence CATCAGAGTGAGCCCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917219744_917219749 28 Left 917219744 1:172716293-172716315 CCTCTAGGGAGATGCCTGAGCAG No data
Right 917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG No data
917219746_917219749 -10 Left 917219746 1:172716331-172716353 CCAGTTTCTACTTCATCAGAGTG No data
Right 917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG No data
917219745_917219749 14 Left 917219745 1:172716307-172716329 CCTGAGCAGCATGTCTAAAACAA No data
Right 917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917219749 Original CRISPR CATCAGAGTGAGCCCCTGGA GGG Intergenic
No off target data available for this crispr