ID: 917220136

View in Genome Browser
Species Human (GRCh38)
Location 1:172719925-172719947
Sequence ACTGCTGATGCTCCACAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917220136_917220141 -6 Left 917220136 1:172719925-172719947 CCCAACTGTGGAGCATCAGCAGT No data
Right 917220141 1:172719942-172719964 AGCAGTGAGGCTCAATGCTGGGG No data
917220136_917220143 2 Left 917220136 1:172719925-172719947 CCCAACTGTGGAGCATCAGCAGT No data
Right 917220143 1:172719950-172719972 GGCTCAATGCTGGGGGAGCTTGG No data
917220136_917220142 -5 Left 917220136 1:172719925-172719947 CCCAACTGTGGAGCATCAGCAGT No data
Right 917220142 1:172719943-172719965 GCAGTGAGGCTCAATGCTGGGGG No data
917220136_917220139 -8 Left 917220136 1:172719925-172719947 CCCAACTGTGGAGCATCAGCAGT No data
Right 917220139 1:172719940-172719962 TCAGCAGTGAGGCTCAATGCTGG No data
917220136_917220140 -7 Left 917220136 1:172719925-172719947 CCCAACTGTGGAGCATCAGCAGT No data
Right 917220140 1:172719941-172719963 CAGCAGTGAGGCTCAATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917220136 Original CRISPR ACTGCTGATGCTCCACAGTT GGG (reversed) Intergenic
No off target data available for this crispr