ID: 917220459

View in Genome Browser
Species Human (GRCh38)
Location 1:172723096-172723118
Sequence TGAGGTGCAAATTATTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917220455_917220459 2 Left 917220455 1:172723071-172723093 CCAGGTGGGCTGGAACTTCTCCA No data
Right 917220459 1:172723096-172723118 TGAGGTGCAAATTATTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917220459 Original CRISPR TGAGGTGCAAATTATTAGCA GGG Intergenic
No off target data available for this crispr