ID: 917222648

View in Genome Browser
Species Human (GRCh38)
Location 1:172748409-172748431
Sequence CTGTAAGCATGCAGCCGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917222648_917222652 1 Left 917222648 1:172748409-172748431 CCCGGGCGGCTGCATGCTTACAG No data
Right 917222652 1:172748433-172748455 CGCAGAGGTCAGAGAGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917222648 Original CRISPR CTGTAAGCATGCAGCCGCCC GGG (reversed) Intergenic
No off target data available for this crispr