ID: 917223872

View in Genome Browser
Species Human (GRCh38)
Location 1:172761210-172761232
Sequence TCTCCATACTTTACTACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917223872_917223878 25 Left 917223872 1:172761210-172761232 CCCTGTGTAGTAAAGTATGGAGA No data
Right 917223878 1:172761258-172761280 ACAGGTTCAGAAAAAACAAAAGG No data
917223872_917223875 -9 Left 917223872 1:172761210-172761232 CCCTGTGTAGTAAAGTATGGAGA No data
Right 917223875 1:172761224-172761246 GTATGGAGACTAATATACATGGG No data
917223872_917223879 26 Left 917223872 1:172761210-172761232 CCCTGTGTAGTAAAGTATGGAGA No data
Right 917223879 1:172761259-172761281 CAGGTTCAGAAAAAACAAAAGGG No data
917223872_917223876 7 Left 917223872 1:172761210-172761232 CCCTGTGTAGTAAAGTATGGAGA No data
Right 917223876 1:172761240-172761262 ACATGGGCAGCCTCTCTCACAGG No data
917223872_917223880 29 Left 917223872 1:172761210-172761232 CCCTGTGTAGTAAAGTATGGAGA No data
Right 917223880 1:172761262-172761284 GTTCAGAAAAAACAAAAGGGAGG No data
917223872_917223874 -10 Left 917223872 1:172761210-172761232 CCCTGTGTAGTAAAGTATGGAGA No data
Right 917223874 1:172761223-172761245 AGTATGGAGACTAATATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917223872 Original CRISPR TCTCCATACTTTACTACACA GGG (reversed) Intergenic
No off target data available for this crispr