ID: 917223876

View in Genome Browser
Species Human (GRCh38)
Location 1:172761240-172761262
Sequence ACATGGGCAGCCTCTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917223873_917223876 6 Left 917223873 1:172761211-172761233 CCTGTGTAGTAAAGTATGGAGAC No data
Right 917223876 1:172761240-172761262 ACATGGGCAGCCTCTCTCACAGG No data
917223872_917223876 7 Left 917223872 1:172761210-172761232 CCCTGTGTAGTAAAGTATGGAGA No data
Right 917223876 1:172761240-172761262 ACATGGGCAGCCTCTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917223876 Original CRISPR ACATGGGCAGCCTCTCTCAC AGG Intergenic
No off target data available for this crispr