ID: 917226647

View in Genome Browser
Species Human (GRCh38)
Location 1:172790753-172790775
Sequence ATCTCTGCTGATGCGTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917226647_917226650 -6 Left 917226647 1:172790753-172790775 CCTGGGGACGCATCAGCAGAGAT No data
Right 917226650 1:172790770-172790792 AGAGATTTCTGGAGGAAATGTGG No data
917226647_917226653 4 Left 917226647 1:172790753-172790775 CCTGGGGACGCATCAGCAGAGAT No data
Right 917226653 1:172790780-172790802 GGAGGAAATGTGGGGATAAATGG No data
917226647_917226659 26 Left 917226647 1:172790753-172790775 CCTGGGGACGCATCAGCAGAGAT No data
Right 917226659 1:172790802-172790824 GAGGAGGGAAGGAGGTTCAGAGG No data
917226647_917226656 11 Left 917226647 1:172790753-172790775 CCTGGGGACGCATCAGCAGAGAT No data
Right 917226656 1:172790787-172790809 ATGTGGGGATAAATGGAGGAGGG No data
917226647_917226655 10 Left 917226647 1:172790753-172790775 CCTGGGGACGCATCAGCAGAGAT No data
Right 917226655 1:172790786-172790808 AATGTGGGGATAAATGGAGGAGG No data
917226647_917226657 15 Left 917226647 1:172790753-172790775 CCTGGGGACGCATCAGCAGAGAT No data
Right 917226657 1:172790791-172790813 GGGGATAAATGGAGGAGGGAAGG No data
917226647_917226651 -5 Left 917226647 1:172790753-172790775 CCTGGGGACGCATCAGCAGAGAT No data
Right 917226651 1:172790771-172790793 GAGATTTCTGGAGGAAATGTGGG No data
917226647_917226654 7 Left 917226647 1:172790753-172790775 CCTGGGGACGCATCAGCAGAGAT No data
Right 917226654 1:172790783-172790805 GGAAATGTGGGGATAAATGGAGG No data
917226647_917226652 -4 Left 917226647 1:172790753-172790775 CCTGGGGACGCATCAGCAGAGAT No data
Right 917226652 1:172790772-172790794 AGATTTCTGGAGGAAATGTGGGG No data
917226647_917226658 18 Left 917226647 1:172790753-172790775 CCTGGGGACGCATCAGCAGAGAT No data
Right 917226658 1:172790794-172790816 GATAAATGGAGGAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917226647 Original CRISPR ATCTCTGCTGATGCGTCCCC AGG (reversed) Intergenic
No off target data available for this crispr