ID: 917226659

View in Genome Browser
Species Human (GRCh38)
Location 1:172790802-172790824
Sequence GAGGAGGGAAGGAGGTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917226647_917226659 26 Left 917226647 1:172790753-172790775 CCTGGGGACGCATCAGCAGAGAT No data
Right 917226659 1:172790802-172790824 GAGGAGGGAAGGAGGTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917226659 Original CRISPR GAGGAGGGAAGGAGGTTCAG AGG Intergenic
No off target data available for this crispr