ID: 917227296

View in Genome Browser
Species Human (GRCh38)
Location 1:172799022-172799044
Sequence CTGATTATGAGAGGTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917227293_917227296 30 Left 917227293 1:172798969-172798991 CCAGCATGTTGAGTAGGCGATAC No data
Right 917227296 1:172799022-172799044 CTGATTATGAGAGGTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917227296 Original CRISPR CTGATTATGAGAGGTGAAGC TGG Intergenic
No off target data available for this crispr