ID: 917233705

View in Genome Browser
Species Human (GRCh38)
Location 1:172866351-172866373
Sequence CACGAAGCCCAGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917233701_917233705 10 Left 917233701 1:172866318-172866340 CCAGTTAGGCAAATCTTAGTGAG No data
Right 917233705 1:172866351-172866373 CACGAAGCCCAGATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917233705 Original CRISPR CACGAAGCCCAGATGGAGCT GGG Intergenic
No off target data available for this crispr