ID: 917239713

View in Genome Browser
Species Human (GRCh38)
Location 1:172934389-172934411
Sequence CATCCAGATGGCCAGTCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917239709_917239713 -8 Left 917239709 1:172934374-172934396 CCCCTGACACTACAGCATCCAGA No data
Right 917239713 1:172934389-172934411 CATCCAGATGGCCAGTCATCTGG No data
917239710_917239713 -9 Left 917239710 1:172934375-172934397 CCCTGACACTACAGCATCCAGAT No data
Right 917239713 1:172934389-172934411 CATCCAGATGGCCAGTCATCTGG No data
917239711_917239713 -10 Left 917239711 1:172934376-172934398 CCTGACACTACAGCATCCAGATG No data
Right 917239713 1:172934389-172934411 CATCCAGATGGCCAGTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917239713 Original CRISPR CATCCAGATGGCCAGTCATC TGG Intergenic
No off target data available for this crispr