ID: 917241258

View in Genome Browser
Species Human (GRCh38)
Location 1:172951032-172951054
Sequence TATCACATGGAGCAGAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917241258_917241261 0 Left 917241258 1:172951032-172951054 CCATGTCTCTGCTCCATGTGATA No data
Right 917241261 1:172951055-172951077 TCAGCTCAAGCTGTTTATGTGGG No data
917241258_917241260 -1 Left 917241258 1:172951032-172951054 CCATGTCTCTGCTCCATGTGATA No data
Right 917241260 1:172951054-172951076 ATCAGCTCAAGCTGTTTATGTGG No data
917241258_917241262 1 Left 917241258 1:172951032-172951054 CCATGTCTCTGCTCCATGTGATA No data
Right 917241262 1:172951056-172951078 CAGCTCAAGCTGTTTATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917241258 Original CRISPR TATCACATGGAGCAGAGACA TGG (reversed) Intergenic
No off target data available for this crispr