ID: 917245180

View in Genome Browser
Species Human (GRCh38)
Location 1:172993173-172993195
Sequence CCTGCTTAGCAGTTATTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917245175_917245180 3 Left 917245175 1:172993147-172993169 CCTCTATAGCACCATAGAAAACT No data
Right 917245180 1:172993173-172993195 CCTGCTTAGCAGTTATTGGGAGG No data
917245174_917245180 20 Left 917245174 1:172993130-172993152 CCACTATACATTAGTATCCTCTA No data
Right 917245180 1:172993173-172993195 CCTGCTTAGCAGTTATTGGGAGG No data
917245176_917245180 -8 Left 917245176 1:172993158-172993180 CCATAGAAAACTGTTCCTGCTTA No data
Right 917245180 1:172993173-172993195 CCTGCTTAGCAGTTATTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917245180 Original CRISPR CCTGCTTAGCAGTTATTGGG AGG Intergenic
No off target data available for this crispr