ID: 917245180 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:172993173-172993195 |
Sequence | CCTGCTTAGCAGTTATTGGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
917245175_917245180 | 3 | Left | 917245175 | 1:172993147-172993169 | CCTCTATAGCACCATAGAAAACT | No data | ||
Right | 917245180 | 1:172993173-172993195 | CCTGCTTAGCAGTTATTGGGAGG | No data | ||||
917245174_917245180 | 20 | Left | 917245174 | 1:172993130-172993152 | CCACTATACATTAGTATCCTCTA | No data | ||
Right | 917245180 | 1:172993173-172993195 | CCTGCTTAGCAGTTATTGGGAGG | No data | ||||
917245176_917245180 | -8 | Left | 917245176 | 1:172993158-172993180 | CCATAGAAAACTGTTCCTGCTTA | No data | ||
Right | 917245180 | 1:172993173-172993195 | CCTGCTTAGCAGTTATTGGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
917245180 | Original CRISPR | CCTGCTTAGCAGTTATTGGG AGG | Intergenic | ||
No off target data available for this crispr |