ID: 917245304

View in Genome Browser
Species Human (GRCh38)
Location 1:172994782-172994804
Sequence CTAAAGTTTTTGGCCAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917245304_917245311 29 Left 917245304 1:172994782-172994804 CCTTATTTGGCCAAAAACTTTAG No data
Right 917245311 1:172994834-172994856 TATATAATTCGAGATTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917245304 Original CRISPR CTAAAGTTTTTGGCCAAATA AGG (reversed) Intergenic
No off target data available for this crispr