ID: 917247587

View in Genome Browser
Species Human (GRCh38)
Location 1:173021450-173021472
Sequence CAGGAGGAGTTGCATGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917247587_917247591 -4 Left 917247587 1:173021450-173021472 CCCATCTCATGCAACTCCTCCTG No data
Right 917247591 1:173021469-173021491 CCTGAGTTCCAGCTGCATACTGG No data
917247587_917247593 10 Left 917247587 1:173021450-173021472 CCCATCTCATGCAACTCCTCCTG No data
Right 917247593 1:173021483-173021505 GCATACTGGTAAAGCCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917247587 Original CRISPR CAGGAGGAGTTGCATGAGAT GGG (reversed) Intergenic
No off target data available for this crispr