ID: 917247591

View in Genome Browser
Species Human (GRCh38)
Location 1:173021469-173021491
Sequence CCTGAGTTCCAGCTGCATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917247586_917247591 26 Left 917247586 1:173021420-173021442 CCAGAAGGCTGTTGACTTTTAAA No data
Right 917247591 1:173021469-173021491 CCTGAGTTCCAGCTGCATACTGG No data
917247585_917247591 27 Left 917247585 1:173021419-173021441 CCCAGAAGGCTGTTGACTTTTAA No data
Right 917247591 1:173021469-173021491 CCTGAGTTCCAGCTGCATACTGG No data
917247587_917247591 -4 Left 917247587 1:173021450-173021472 CCCATCTCATGCAACTCCTCCTG No data
Right 917247591 1:173021469-173021491 CCTGAGTTCCAGCTGCATACTGG No data
917247588_917247591 -5 Left 917247588 1:173021451-173021473 CCATCTCATGCAACTCCTCCTGA No data
Right 917247591 1:173021469-173021491 CCTGAGTTCCAGCTGCATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917247591 Original CRISPR CCTGAGTTCCAGCTGCATAC TGG Intergenic
No off target data available for this crispr