ID: 917247593

View in Genome Browser
Species Human (GRCh38)
Location 1:173021483-173021505
Sequence GCATACTGGTAAAGCCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917247587_917247593 10 Left 917247587 1:173021450-173021472 CCCATCTCATGCAACTCCTCCTG No data
Right 917247593 1:173021483-173021505 GCATACTGGTAAAGCCCACTTGG No data
917247590_917247593 -9 Left 917247590 1:173021469-173021491 CCTGAGTTCCAGCTGCATACTGG No data
Right 917247593 1:173021483-173021505 GCATACTGGTAAAGCCCACTTGG No data
917247589_917247593 -6 Left 917247589 1:173021466-173021488 CCTCCTGAGTTCCAGCTGCATAC No data
Right 917247593 1:173021483-173021505 GCATACTGGTAAAGCCCACTTGG No data
917247588_917247593 9 Left 917247588 1:173021451-173021473 CCATCTCATGCAACTCCTCCTGA No data
Right 917247593 1:173021483-173021505 GCATACTGGTAAAGCCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917247593 Original CRISPR GCATACTGGTAAAGCCCACT TGG Intergenic
No off target data available for this crispr