ID: 917247661

View in Genome Browser
Species Human (GRCh38)
Location 1:173022229-173022251
Sequence TAGAACAAAAAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917247661_917247669 23 Left 917247661 1:173022229-173022251 CCTTCCTCCTCCTTTTTGTTCTA No data
Right 917247669 1:173022275-173022297 GATGCCCACCTTCATTGGTAAGG No data
917247661_917247666 -9 Left 917247661 1:173022229-173022251 CCTTCCTCCTCCTTTTTGTTCTA No data
Right 917247666 1:173022243-173022265 TTTGTTCTATTCAGGCCTTCAGG No data
917247661_917247668 18 Left 917247661 1:173022229-173022251 CCTTCCTCCTCCTTTTTGTTCTA No data
Right 917247668 1:173022270-173022292 TGCATGATGCCCACCTTCATTGG No data
917247661_917247670 24 Left 917247661 1:173022229-173022251 CCTTCCTCCTCCTTTTTGTTCTA No data
Right 917247670 1:173022276-173022298 ATGCCCACCTTCATTGGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917247661 Original CRISPR TAGAACAAAAAGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr