ID: 917249317

View in Genome Browser
Species Human (GRCh38)
Location 1:173040274-173040296
Sequence CTGCTCACCTTGGGCTAAAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917249317 Original CRISPR CTGCTCACCTTGGGCTAAAG GGG Exonic
900159224 1:1215652-1215674 CTGCTCTCCTGGGGCCTAAGTGG + Intergenic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901632187 1:10653369-10653391 CTGCTCACCTGGGTCAAAGGTGG + Exonic
909034568 1:70582235-70582257 CAGCTATCCTTGGCCTAAAGAGG - Intergenic
912168813 1:107072427-107072449 ATGCTTACCTAGGGCTAAAGAGG - Intergenic
912472501 1:109915207-109915229 CTGCTGCTCTGGGGCTAAAGAGG + Intronic
912565155 1:110582277-110582299 CTTCTCCCCTTGAGCTAAGGTGG + Intergenic
914723408 1:150307817-150307839 CTGCTCACCTTGGGCTCCCAGGG + Intronic
915140996 1:153768486-153768508 GTGCTGACCTTTGGCCAAAGAGG - Intronic
915727776 1:158030923-158030945 CTGCTCATCCTGGTCCAAAGTGG + Intronic
917249317 1:173040274-173040296 CTGCTCACCTTGGGCTAAAGGGG + Exonic
919644099 1:200075635-200075657 CTGCTCAACTTGTGCTACAACGG - Intronic
920022938 1:202969130-202969152 CTGCTCCACTCTGGCTAAAGAGG + Intergenic
920389752 1:205592021-205592043 CTGGGCTCCTTGGGCTAGAGAGG + Intronic
920464984 1:206175631-206175653 CTGCTCTCCTTGGCCTGTAGAGG - Intergenic
1064134397 10:12737740-12737762 TTACTCACTTTGGGGTAAAGGGG + Intronic
1065979199 10:30874661-30874683 CTGCTCACTTTGGTTTAAAATGG + Intronic
1068761812 10:60720695-60720717 CTCCACATCTTGGGCTCAAGCGG + Intronic
1071568753 10:86685076-86685098 CTGCTCCTCTTGGGGTATAGGGG - Intronic
1075793459 10:125102497-125102519 CTGCAAACCCTGGGCTTAAGTGG - Intronic
1076625047 10:131816482-131816504 CTGCCCACTTTGGCCCAAAGTGG - Intergenic
1076874412 10:133208593-133208615 CAGCTCACCTTGGGAGAACGGGG - Intronic
1078339161 11:10486691-10486713 CTGCCCACCTTGGGTTGCAGAGG - Intronic
1079755357 11:24252514-24252536 CTGATCATGTTGGGCCAAAGAGG - Intergenic
1081683298 11:45023818-45023840 CTCCTCACCATGGCCTAGAGGGG + Intergenic
1083172406 11:60930746-60930768 CTGCTCACCTGGGGATCTAGAGG - Intronic
1084380922 11:68812216-68812238 CTTCTCACCCTGGTCTACAGAGG + Intronic
1086136764 11:83449382-83449404 CAGCCCAGCTTGGGCTACAGAGG + Intergenic
1086184067 11:83992370-83992392 CGGCCTACCTTGGGCTAGAGGGG + Intronic
1086372108 11:86165178-86165200 CTGCCCATCTGGGGCTAAAGCGG - Intergenic
1086556596 11:88118365-88118387 ATGCTGACCTTGGGTTAATGGGG - Intronic
1086830024 11:91550752-91550774 CTGCTCACCTTAGCTTAAAGTGG - Intergenic
1089644794 11:119871707-119871729 ATGCTGACCTTGGGGCAAAGGGG - Intergenic
1096772502 12:53945008-53945030 CTGCTCACCTCGGGCTGCAGGGG - Exonic
1100953113 12:99875019-99875041 CTCCTGGCCTTGGGGTAAAGAGG + Intronic
1103887488 12:124213808-124213830 CTGCCCAGCTTAGGCTAAGGAGG + Intronic
1105275664 13:18922014-18922036 TTACTGACCTTGGGCTAAAACGG + Intergenic
1106987070 13:35366666-35366688 CTGCTTACATTGGGGGAAAGAGG - Intronic
1107619296 13:42209097-42209119 CTGCACTTCTTGGGCTAAGGAGG + Intronic
1107865085 13:44695485-44695507 CTGCTCAGCCTGTGCTCAAGCGG + Intergenic
1110863265 13:80367235-80367257 CAGATCACCTTGGCCTAGAGGGG + Intergenic
1110923979 13:81127048-81127070 CTGCTAACTTTGGGCTGAATTGG - Intergenic
1111532358 13:89554687-89554709 CTGCTCATTTTGGGATAAAGAGG + Intergenic
1113784515 13:112995508-112995530 CTGCTCTCCTGGGGCAGAAGTGG - Intronic
1115336288 14:32246828-32246850 CTGATGGCCTTGAGCTAAAGGGG - Intergenic
1115510572 14:34134049-34134071 CTGCTCTACTTGATCTAAAGAGG - Intronic
1118682886 14:68261746-68261768 CTGCTCACTTTGGGATAAGCAGG - Intronic
1119400644 14:74360058-74360080 ATGCTCCCCTTTGGCTTAAGGGG + Intergenic
1122271382 14:100569821-100569843 CTGCTCTCCAGGGGCTAATGAGG + Intronic
1122691220 14:103532976-103532998 CTCCTCACCTCAGGCCAAAGTGG - Intronic
1126804808 15:52337116-52337138 CTGCTTACCTAGGACCAAAGTGG + Intronic
1127900688 15:63338811-63338833 CTCCTCACCTTGGGAGAAGGAGG + Exonic
1133630854 16:7619884-7619906 CTTCTCACCTTTGCCTACAGTGG + Intronic
1139335529 16:66228343-66228365 CTGCTGACCTTGGGGTCAGGTGG - Intergenic
1141814911 16:86403181-86403203 ACGCGCACCTTGGGCTACAGGGG - Intergenic
1146399921 17:32494321-32494343 TGGCTCACCTTGGGCAAGAGAGG + Exonic
1147967437 17:44200476-44200498 CTGCACGCCTCGGGGTAAAGGGG - Intergenic
1156700691 18:39820862-39820884 CTGCTGACCTTGGGCTGAACTGG + Intergenic
1163642671 19:18470351-18470373 CTGCTCAGGTTGGGGTAGAGGGG + Intronic
929407216 2:41656551-41656573 CTGCTGTCCTTGCGATAAAGAGG + Intergenic
930746378 2:54887242-54887264 CTGACAACCTTGGGCTAAATTGG + Intronic
942013819 2:171790943-171790965 CTGCTTACTTTGGTCTAATGAGG + Intronic
946402359 2:219475222-219475244 CTGATCAACATGGGCTAAACAGG + Intronic
947166667 2:227268873-227268895 CTGCTCCCCTTGAGCCAAAGAGG - Intronic
948007991 2:234626374-234626396 CTGCTCACTTTGGGTTTAATTGG + Intergenic
1169086873 20:2831760-2831782 CTGCCCGCCTTGGCCTACAGGGG + Intergenic
1179074617 21:38108381-38108403 ATGCTTGCCTTGGGCTACAGGGG + Intronic
1181043865 22:20205475-20205497 CTCCTCTCCTGGGGCTAAGGAGG - Intergenic
1181306396 22:21919701-21919723 CTGCCCCCCTTGAGCTACAGAGG + Exonic
949503768 3:4706835-4706857 CTGCTCTCCTTTTGTTAAAGGGG + Intronic
951174227 3:19580227-19580249 CTGCTGTCCTTAGGCTTAAGTGG - Intergenic
953770217 3:45773980-45774002 TTGCTCACCTTGGGGGAAGGAGG - Intronic
954470739 3:50692524-50692546 CTGCTCACCTTGTGCTTTTGCGG + Intronic
956575598 3:70749197-70749219 GTGCCCACCTTGTGATAAAGAGG - Intergenic
956681604 3:71786019-71786041 CTGCGTACCTAGGGCTTAAGGGG - Intergenic
961122947 3:124389049-124389071 CTGCTCAACTTTTGCTAAAGTGG + Intronic
969705635 4:8789691-8789713 GTGCTCACCTAGGGCTACAGTGG + Intergenic
973005351 4:44998708-44998730 CTTCTCACCTTTTGCTTAAGTGG - Intergenic
973839733 4:54849066-54849088 CTGCTCTCCTTTGGATAAATAGG + Intergenic
980419600 4:132542584-132542606 CTGATGACCTTGAGCTGAAGGGG + Intergenic
980896611 4:138866473-138866495 GTCCTCACCTTGGGGCAAAGCGG - Intergenic
983166343 4:164481748-164481770 CTGCTCAGCTTGGGGGAAAAAGG + Intergenic
985229370 4:187798745-187798767 CTTGCCACCATGGGCTAAAGGGG + Intergenic
986303084 5:6493900-6493922 CTTCTCACCCTGGGCTCCAGAGG - Exonic
986734648 5:10660072-10660094 CTGCCCACGCTGGGCTGAAGTGG + Intergenic
986758022 5:10855854-10855876 CTGCTCTCCTTGTGCAAATGGGG + Intergenic
998064795 5:139149200-139149222 CTGCTCACCTGGGGTTGAAATGG - Intronic
1001241745 5:170076573-170076595 CTGAGCTCCTTGGCCTAAAGAGG + Intronic
1005350424 6:24929336-24929358 CTGCACACCCTAGGCTGAAGAGG - Intronic
1005807777 6:29491106-29491128 CTGCTCACCTTGGGCAGGTGTGG + Intergenic
1018081720 6:160264650-160264672 ATGCTCCCATTGGCCTAAAGTGG + Intronic
1022108127 7:27211182-27211204 CTGCTCCCCTAGGGAGAAAGGGG + Intergenic
1022649748 7:32263667-32263689 CTGATTACATAGGGCTAAAGAGG - Intronic
1022791370 7:33692500-33692522 CAGCTCTTCTTGGCCTAAAGTGG - Intergenic
1024147949 7:46536356-46536378 CTGCTCAGCTCCAGCTAAAGGGG + Intergenic
1027235896 7:76297667-76297689 CTGCTCACCTTGGCCCAGACGGG - Intergenic
1028488531 7:91385938-91385960 CTGTTCTCCTTGGGCTCAAGTGG - Intergenic
1028833006 7:95346141-95346163 CTGATGACCTTGAGCTGAAGGGG + Intergenic
1035775883 8:2187814-2187836 CAGCTAACTTTTGGCTAAAGTGG + Intergenic
1040946841 8:52893424-52893446 CCGCTGACCCTGGGCTGAAGTGG - Intergenic
1044659136 8:94578529-94578551 CTGATGACCTTGAGCTGAAGGGG - Intergenic
1045449192 8:102303447-102303469 CTGCTCACTATGTGCTAATGTGG - Intronic
1052981302 9:34451629-34451651 CTGCTCACTCTGGGCTATATAGG + Intronic
1061876158 9:133545193-133545215 CTGCACCCCTTGGGCCACAGTGG + Intronic
1185669426 X:1794558-1794580 CTGCTCTCCCAGGGGTAAAGGGG + Intergenic
1190887125 X:54539972-54539994 CTGCTCACCTTGGGAGTGAGGGG + Intronic
1192236160 X:69297459-69297481 CTGCTCACCTTTCTCTACAGAGG + Intergenic
1198007828 X:132516808-132516830 CTGCTCCTCTTGGGCCAAAAAGG + Intergenic
1199974489 X:152884966-152884988 CTGCTCAGCTTGGGAAAAAGGGG - Intergenic