ID: 917250038

View in Genome Browser
Species Human (GRCh38)
Location 1:173048949-173048971
Sequence GTTTCTATGGGAAAAGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917250038 Original CRISPR GTTTCTATGGGAAAAGCCAG TGG (reversed) Intronic
901188428 1:7389554-7389576 GTTTCTAAGGGAACAGTCAAGGG - Intronic
902502957 1:16922644-16922666 GTGTCTGTGGGAAAAGCGAGAGG - Exonic
903437356 1:23360914-23360936 GTTTCTATTAGAAAAACCACAGG + Exonic
903486759 1:23695155-23695177 GTTTCTATAGGAAGAACCAGGGG - Intronic
903843240 1:26259918-26259940 GATTCTGTGTGAGAAGCCAGTGG - Intronic
904914584 1:33960651-33960673 GTTTCCATGGGAAATGCGTGCGG - Intronic
905172447 1:36117096-36117118 GTTTCCATGGGAGCAGGCAGAGG - Intronic
906874436 1:49521626-49521648 TTTTCTATGGTAAAAGATAGGGG - Intronic
906955615 1:50371334-50371356 GTTTCTGTGGGACATGCAAGTGG - Intergenic
908642491 1:66240853-66240875 ATTTCTGTGGGAAAAGACTGAGG + Intronic
910729365 1:90375969-90375991 GTTTCATTGGGAGCAGCCAGAGG - Intergenic
911225354 1:95298392-95298414 GTCTTAGTGGGAAAAGCCAGTGG - Intergenic
913108842 1:115640547-115640569 GTTCCTATGGGTAAAGCCAATGG - Intergenic
913141440 1:115945221-115945243 GTTTGAGTGGGAAAAGCCAGAGG + Intergenic
914418013 1:147502480-147502502 GTCTTTATGGGTAAAGCGAGTGG + Intergenic
914694736 1:150067124-150067146 GTTTCTGGGGGAAAGGCCTGAGG - Intergenic
915773391 1:158454992-158455014 ATTGCTATGAGAAAAGCCAAGGG - Intergenic
917250038 1:173048949-173048971 GTTTCTATGGGAAAAGCCAGTGG - Intronic
919272887 1:195373619-195373641 GTTTTGATGGGAAAAGCTTGAGG + Intergenic
923380967 1:233417433-233417455 GTTACTATAGTAAAGGCCAGTGG + Intergenic
924158187 1:241203117-241203139 GTTTCAATGAGAAAAACCACAGG - Intronic
924937383 1:248783732-248783754 CTCTCTCTGGGCAAAGCCAGTGG + Intergenic
1064899147 10:20274802-20274824 GTATCTATGGGGAAACACAGTGG - Intronic
1066003313 10:31124841-31124863 TTTTCAATGGGAAAGTCCAGGGG + Intergenic
1066644883 10:37596278-37596300 ATTTTCATGGGAAAGGCCAGAGG - Intergenic
1068302469 10:55162253-55162275 GTTTCTAAGGGAAAACACTGAGG - Intronic
1068521223 10:58079871-58079893 GGTTCCATGGGATGAGCCAGGGG - Intergenic
1069671187 10:70205543-70205565 AATTATAAGGGAAAAGCCAGTGG - Intronic
1070187228 10:74076301-74076323 ATTTCTTTGGGAAAAGCTAAAGG + Intronic
1070901031 10:80029275-80029297 GTTTCTAAGCCCAAAGCCAGTGG + Intergenic
1070902759 10:80045032-80045054 GTTTCTAAGCCCAAAGCCAGTGG + Intergenic
1071712631 10:88064582-88064604 GTTTCTATGAAAGAAGCCAGAGG - Intergenic
1071979947 10:90994700-90994722 GTTTCTCTGGGAGAAGGCACAGG - Intergenic
1072788610 10:98301732-98301754 TTTCTTATGGGAAGAGCCAGCGG - Intergenic
1074091297 10:110260026-110260048 GTTATTTTGGGAAAAGCCAATGG + Intronic
1076028577 10:127138645-127138667 GTTTCTTTGGGAGAAGCGTGGGG + Intronic
1076657235 10:132032799-132032821 GTTTCTTTAGGAAAAGCTGGAGG - Intergenic
1078050266 11:7959678-7959700 GCTTCTACTGGAAAAGGCAGAGG - Exonic
1078364138 11:10692830-10692852 TTTTCCAAAGGAAAAGCCAGTGG - Intronic
1083629418 11:64088064-64088086 GTGCCTATGGGAAGAGCCAGGGG - Intronic
1083742061 11:64716355-64716377 GGTTCTGTGGGAAAGGCGAGGGG + Intronic
1084207487 11:67604451-67604473 GCTTGTATGGGCAAAGCCAAAGG + Exonic
1085247848 11:75118772-75118794 GGATATATGGGAAGAGCCAGAGG + Intronic
1089001150 11:115053522-115053544 GTTTCTATGTTCAAAACCAGTGG + Intergenic
1089416736 11:118298321-118298343 ATTGCTTTAGGAAAAGCCAGTGG + Intergenic
1091940319 12:4474008-4474030 ATTTCTATGGGGAATGCCACTGG - Intergenic
1092898459 12:13036393-13036415 GTTTCAATGTGAGAAGCAAGAGG - Intergenic
1093810952 12:23491501-23491523 CTGTCTATGGGGAAAGCCAATGG + Intergenic
1097052091 12:56229875-56229897 CTTTCTGTGGGAAAAGGAAGAGG + Intergenic
1097910998 12:64969099-64969121 TTTTCTATGGGGCTAGCCAGGGG + Intergenic
1099906942 12:88782665-88782687 GACTCTATGGGAAAAGCTACAGG - Intergenic
1100111972 12:91256584-91256606 CATTCCGTGGGAAAAGCCAGGGG + Intergenic
1100342968 12:93699050-93699072 GCTTTTTTGGGAAAAGCCACAGG - Intronic
1100912649 12:99383032-99383054 GTATCTCTGGGAAAGGACAGAGG - Intronic
1102486021 12:113257657-113257679 GTTTCTTTTGGTAAAGCTAGAGG - Intronic
1104495686 12:129235872-129235894 ATTTCTATGAGAAATGCCATTGG + Intronic
1104914373 12:132257330-132257352 GTTTTTATGGCAAAGCCCAGGGG + Intronic
1110777244 13:79422178-79422200 CTTACTTTGGGGAAAGCCAGTGG - Intergenic
1112124574 13:96450294-96450316 GTTCCTATGGCAAATACCAGTGG - Intronic
1112746278 13:102530810-102530832 GTATCTAAGGGAATAGCAAGAGG - Intergenic
1113080794 13:106517686-106517708 GATTCACTGGGAAAAGCCACTGG - Intronic
1113802810 13:113095348-113095370 GTCTCTGTGGGAGAGGCCAGAGG - Intronic
1114184305 14:20388460-20388482 GTATCCAGAGGAAAAGCCAGGGG + Intronic
1114277766 14:21163091-21163113 GTTTCTCTGGAAACAGGCAGTGG - Intergenic
1114859289 14:26495146-26495168 GCTGCTATGGGAAAAGCCAGTGG - Intronic
1115957754 14:38799864-38799886 GTTGCTATGGGAACAGTGAGTGG + Intergenic
1116983617 14:51196390-51196412 GGTTAAATGTGAAAAGCCAGTGG + Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1121593404 14:95137687-95137709 GTTTGTAAGGGAAAAGTCAAGGG + Intronic
1123479463 15:20617574-20617596 GATTCACTGGGAAAACCCAGAGG - Intergenic
1123638544 15:22382790-22382812 GATTCACTGGGAAAACCCAGAGG + Intergenic
1125747641 15:42008071-42008093 GTGTCTATGAGAATGGCCAGTGG - Intronic
1126483531 15:49154817-49154839 ATTTCTAAGGGAAAAGCCATGGG + Intronic
1128273378 15:66331817-66331839 GTTTCTTTGGGGAATGCCAGGGG + Intronic
1130795383 15:87203234-87203256 GTTTCTATGGGATTCGCCTGTGG + Intergenic
1131942023 15:97577296-97577318 CTTTCCATGGGAAAAGTAAGAGG + Intergenic
1133556809 16:6913592-6913614 GTTGCTCTGGGAAAAGCTTGGGG - Intronic
1134679325 16:16113115-16113137 GTGGCTTTGGGAAAACCCAGCGG + Intronic
1135263303 16:20999879-20999901 GTTGCTTTTGGAAATGCCAGCGG + Intronic
1136581206 16:31152041-31152063 GTTTCAATGAAAAGAGCCAGGGG - Intergenic
1136704560 16:32175604-32175626 GTTTGCAGGGGAAAACCCAGTGG - Intergenic
1136763353 16:32753802-32753824 GTTTGCAGGGGAAAACCCAGTGG + Intergenic
1136804747 16:33116584-33116606 GTTTGCAGGGGAAAACCCAGTGG - Intergenic
1137728491 16:50672989-50673011 TTTTTAATGGGAAAAGCCACTGG - Exonic
1138009316 16:53362741-53362763 GTTTCTATGGGGAGAGTCAAAGG + Intergenic
1139007978 16:62596778-62596800 CTTACTAAGGGGAAAGCCAGAGG - Intergenic
1139285538 16:65810062-65810084 GATTTTATAAGAAAAGCCAGTGG - Intergenic
1139340318 16:66264088-66264110 GGTGCTAGGGGAGAAGCCAGTGG + Intergenic
1139725258 16:68892468-68892490 GTTTGTATTTGAAAAGCCACGGG + Intronic
1141714505 16:85719001-85719023 TATTCTATGGGAATGGCCAGGGG + Intronic
1203065503 16_KI270728v1_random:1014123-1014145 GTTTGCAGGGGAAAACCCAGTGG + Intergenic
1142879346 17:2872305-2872327 GTTTCTTTGGGAATAGCAAGGGG + Intronic
1145765249 17:27454690-27454712 CTCTCAATGGGAAAGGCCAGGGG + Intergenic
1145871744 17:28279456-28279478 GATTGGATGGGAAAAGTCAGTGG - Intergenic
1146590886 17:34127170-34127192 TTTTCTATGTGAAAGGCCAGGGG + Intronic
1147793586 17:43027658-43027680 GTTTCCATGACAAAAGCCAGGGG + Intronic
1148349117 17:46926813-46926835 GATTTGATGGGAAAAGTCAGTGG + Intronic
1148972711 17:51498336-51498358 GTTGGTAGGGGAAAACCCAGTGG + Intergenic
1150177973 17:63082327-63082349 GTATCTATTGGTAAAGCCTGGGG + Intronic
1150506140 17:65700820-65700842 GAATCTATGGGACAAGACAGAGG + Intronic
1151654823 17:75490965-75490987 GCCTCTAGGGGAAAATCCAGGGG - Intronic
1152037211 17:77880776-77880798 GTTTCCCTGGGAAATGACAGAGG + Intergenic
1152112681 17:78365907-78365929 GTTTTTCTGGGAAATGCCAGAGG - Intergenic
1153769843 18:8406705-8406727 GTTTCCAAGGGAAAAGCTTGGGG + Intronic
1155082197 18:22421330-22421352 GTTTCTCTGGGAAATGCCAGGGG - Intergenic
1156338474 18:36189417-36189439 GTTTCTAGGAGAAAAACAAGTGG - Intronic
1160403581 18:78629226-78629248 GCTTCTATTGGCAAATCCAGAGG - Intergenic
1161155237 19:2729147-2729169 GTGTCTGTGGGCAGAGCCAGAGG + Intronic
1165535396 19:36440028-36440050 TTTTCTATTGTAAAAGACAGAGG - Intergenic
925107553 2:1306074-1306096 GGTTCTATGTGAAAGGCCACAGG - Intronic
926563003 2:14438261-14438283 GTTTCTATTTGAAAAGGTAGTGG + Intergenic
926634209 2:15163342-15163364 GTTTCTGAGGGAAAAGCAAGTGG + Intergenic
929038336 2:37718794-37718816 GTTTTTATGGGAACAGAAAGTGG + Intronic
929996490 2:46829311-46829333 GTCTCTGTGGCAGAAGCCAGAGG - Intronic
930539014 2:52681092-52681114 CTTTCCCTGGGAAAAGCCATAGG - Intergenic
932714274 2:74090261-74090283 GTTTACATGGGAAGAGCCTGGGG - Intronic
934109997 2:88733431-88733453 ATTTCTGTGGGCAGAGCCAGGGG + Intronic
935510049 2:103960208-103960230 GTTTCCATTTGGAAAGCCAGTGG + Intergenic
939697087 2:145340095-145340117 GATTCAATGATAAAAGCCAGAGG - Intergenic
941494508 2:166183074-166183096 GTATCTATGGGAAGAGACACAGG + Intergenic
942780968 2:179642455-179642477 GTTTCTATGAGAAAAAAAAGAGG - Intronic
943056143 2:182982989-182983011 CTTTCTATGTGAAAAGTCATTGG + Intronic
944950663 2:204745205-204745227 GCTACCACGGGAAAAGCCAGTGG - Intronic
945463582 2:210140677-210140699 ATTTCTATGGAAAATGCCAGTGG + Intronic
945941890 2:215958848-215958870 GTTTCTATGGGAAAGGGAAAAGG + Intronic
946980556 2:225209604-225209626 GATTCCATGGAAGAAGCCAGAGG + Intergenic
947993939 2:234511502-234511524 GTGTCCATGGGACAACCCAGTGG - Intergenic
1169131787 20:3169548-3169570 GTTGCTTTGGGAAACACCAGAGG + Intronic
1170025196 20:11881652-11881674 GCTTCTGTGGGAAAAACCAATGG - Intergenic
1170121713 20:12919427-12919449 ATTTCTATGGCAAAACCCAGAGG + Intergenic
1170145207 20:13166035-13166057 GTTTGTATGGAAAAAGCCCATGG + Exonic
1171298900 20:24042166-24042188 GGTGCTATGGGAGAATCCAGTGG - Intergenic
1172758630 20:37306198-37306220 GTTTCTATAGGCTAAGCAAGAGG - Intronic
1173929765 20:46808943-46808965 GTTTCTAGGGAAAAAGTCACAGG + Intergenic
1174815995 20:53687592-53687614 CTTTCTGTGGGAAAACCCTGTGG + Intergenic
1175375875 20:58523647-58523669 GTTTGTATGATAAAAGGCAGTGG + Intergenic
1175939270 20:62530455-62530477 GTTTCTAGGAGCAGAGCCAGAGG - Intergenic
1177259460 21:18711532-18711554 GTTTCTAGGGAAAGACCCAGCGG + Intergenic
1177574686 21:22937235-22937257 TTTCCTTTGGGAAAAACCAGAGG + Intergenic
1178828620 21:36035957-36035979 GTTTCTGTAGGAAAAGCAAAAGG + Exonic
1180955053 22:19737823-19737845 GCTCCTATGGGCATAGCCAGGGG - Intergenic
1181806611 22:25378569-25378591 TTTTTGATGAGAAAAGCCAGAGG + Intronic
1183929566 22:41228212-41228234 GGTTCTAAAGGAAAAGCCACAGG + Intronic
1184287228 22:43478509-43478531 CTTCCCATGGGGAAAGCCAGAGG + Intronic
952069114 3:29611625-29611647 CTTTCAATGGATAAAGCCAGAGG + Intronic
954641104 3:52098448-52098470 GTTTCTATTGCTAAAGTCAGTGG - Intronic
956469296 3:69548921-69548943 GTTTGTATTGGAAAAGCCCTAGG - Intergenic
957816809 3:85310931-85310953 GAGTCTATGGGAAAAGTGAGTGG + Intronic
962359526 3:134726213-134726235 CTTTCCGTGGAAAAAGCCAGGGG - Intronic
962611993 3:137085549-137085571 GTTTCTCTGGCAAAAGTCTGGGG + Intergenic
963562273 3:146880837-146880859 ATGTCCCTGGGAAAAGCCAGAGG + Intergenic
965487922 3:169301450-169301472 GATTCTAAGTGAAAAGCCATAGG - Intronic
969895297 4:10298415-10298437 ATTTGCATGGGAAAAGCCAATGG - Intergenic
971363615 4:25958880-25958902 GTTTCTGTGGGAAAGGCAGGAGG + Intergenic
973746471 4:53968165-53968187 GTTTCTCTGGAAGAAGCCACAGG + Intronic
974290022 4:59917770-59917792 GTTTCTATTGAAAAAGTTAGAGG + Intergenic
974684324 4:65205633-65205655 TTTTCTATAAGAAAAGCCAAGGG + Intergenic
975239044 4:72035085-72035107 GTTTCTATGGTAGAAGGCAGAGG + Intronic
977667283 4:99655570-99655592 GTTTCCATGGGGCATGCCAGTGG - Intergenic
978748336 4:112220305-112220327 GGTCCTATGGGAAAGGCTAGTGG + Intergenic
978941969 4:114447774-114447796 GTTTCTATGGTAAAGATCAGAGG + Intergenic
979940229 4:126752931-126752953 GTTTCTAGGGAAACACCCAGAGG - Intergenic
980439581 4:132822974-132822996 GTTAATTTGGGAAAAGCAAGAGG - Intergenic
980561498 4:134482474-134482496 GTTTCTAGGGAATAAGCCAGTGG + Intergenic
982800365 4:159698113-159698135 TTTTCTAGGGCAGAAGCCAGGGG - Intergenic
982868945 4:160551369-160551391 GAATCTATGTGAAAAGCCTGGGG + Intergenic
982902062 4:161019122-161019144 CTTTCTTTGGGAGAAGCCTGAGG - Intergenic
983530027 4:168801148-168801170 GTTACCCTGGGAAAACCCAGGGG + Intronic
989923378 5:49838437-49838459 GTTTCTGTGGGATCTGCCAGCGG + Intergenic
989927425 5:49898056-49898078 GTTTCTGTGGAATATGCCAGCGG + Intergenic
989933052 5:49981853-49981875 GTTTCTGTGGGATCTGCCAGCGG + Intergenic
990949941 5:61288732-61288754 ATTTCTATAGGAAAATCTAGAGG + Intergenic
994120958 5:96112212-96112234 GTGTGTCTGGGGAAAGCCAGTGG + Intergenic
994978866 5:106846436-106846458 TTGTATATGGGAAAAGCCTGGGG + Intergenic
996877925 5:128260388-128260410 GCATCTTTGGTAAAAGCCAGTGG + Intronic
999269813 5:150290141-150290163 GTTGCCATGGTAACAGCCAGTGG + Intronic
999596374 5:153209832-153209854 GGTTCCATGGGGCAAGCCAGCGG + Intergenic
1001480539 5:172086248-172086270 CTGCCTCTGGGAAAAGCCAGAGG + Intronic
1002581734 5:180212838-180212860 GTTTCTGGGGGAGAAGCCACAGG + Intergenic
1006337130 6:33426679-33426701 GTTTCCATGGGAACAGTGAGGGG + Intronic
1006425142 6:33958965-33958987 GATTCTAGGGGACAAGCCAGAGG - Intergenic
1006715665 6:36118381-36118403 GTTTTCATGGGAAAAGGCAGTGG + Intergenic
1013451628 6:110287391-110287413 GTTTCTGTGAAATAAGCCAGTGG - Intronic
1013554748 6:111244899-111244921 TTTGCTATGGAAAAAGACAGAGG + Intergenic
1013910326 6:115268545-115268567 GTTTCCAGGGCAAAAGCAAGAGG + Intergenic
1014004521 6:116402723-116402745 GTTTTAATGGAAAAAGCCAAGGG - Intronic
1014885893 6:126780875-126780897 TTTGCTATGGGATTAGCCAGCGG - Intergenic
1016304385 6:142668338-142668360 GCTTTTGTGGGAAAAGGCAGGGG + Intergenic
1017872685 6:158500541-158500563 TTCTCTAAGGGAAAAGCCACAGG + Intronic
1018028357 6:159822807-159822829 GTGTCTGTGGGAAAATCTAGAGG - Intergenic
1018296407 6:162349941-162349963 GTTTCTATGTGAAAATCCTATGG + Intronic
1018512175 6:164536244-164536266 TTTTTAATGGGAAAAGACAGAGG - Intergenic
1021261922 7:18469079-18469101 CTATCTGTGGGAAAACCCAGAGG - Intronic
1021798418 7:24280726-24280748 GTGTCTATCTGAACAGCCAGAGG + Intergenic
1024419939 7:49153318-49153340 GTTTGTGTGTGAAAAGACAGAGG - Intergenic
1026969199 7:74457723-74457745 GGTTCTTTGGGACAAGCCAGGGG + Intronic
1028126710 7:87121134-87121156 TATTCTATGGAAAATGCCAGGGG - Intergenic
1028506194 7:91572760-91572782 GTTTCTATGGGAAGTACCACAGG + Intergenic
1029295684 7:99538640-99538662 TTTTCTGGGGGAAAGGCCAGTGG - Intergenic
1029513022 7:101008615-101008637 GTTTCTGTGGGAAAAGGCCATGG - Exonic
1031194572 7:118596295-118596317 GTATCTAGGGCAAAAGCCAAAGG - Intergenic
1031584095 7:123513081-123513103 ATTTCTATGGCAAAGGCAAGGGG + Intronic
1033614725 7:143003247-143003269 ATTTCTTTGGGAAAATACAGAGG - Intergenic
1036428943 8:8671648-8671670 GTTTCTATGGGAAAAGTTTTAGG - Intergenic
1038942252 8:32317964-32317986 GTTATTTTGGGAAAAGCAAGTGG - Intronic
1039326516 8:36490896-36490918 GTTTGTATTGGAAAAGGGAGAGG - Intergenic
1039368848 8:36964085-36964107 GTTTCTTTGGAAAAAGCCCAGGG - Intergenic
1039379307 8:37069975-37069997 GTTTCCAAGGGAAAGGCCACAGG + Intergenic
1039420166 8:37431173-37431195 TGTTCTATGGAAAAAGCAAGGGG + Intergenic
1039630035 8:39100700-39100722 TGTTCTATGGTAGAAGCCAGAGG + Intronic
1039798846 8:40937297-40937319 GTTGCTATGGGAAAGGCAAAAGG + Intergenic
1045475976 8:102553057-102553079 GTTTCTTTGGAAAAAGCAATAGG + Intronic
1045903226 8:107310550-107310572 GGTTGTATGGGAAAAGAGAGAGG + Intronic
1045986557 8:108256064-108256086 AATTCCAGGGGAAAAGCCAGGGG - Intronic
1046005999 8:108484990-108485012 GTTTCTAGGGGAAATGCCAGAGG - Intronic
1046570775 8:115962976-115962998 GTCTCCATGGTAAAAGCTAGTGG - Intergenic
1048806299 8:138244489-138244511 GGTCCCATGGGATAAGCCAGAGG + Intronic
1051481585 9:17567890-17567912 GTTACTATGGCTGAAGCCAGAGG + Intergenic
1052372471 9:27681055-27681077 GTTTCTCTGGGAGTAGACAGAGG + Intergenic
1056443588 9:86643707-86643729 GTTACTATGGAGAAAACCAGAGG - Intergenic
1057311954 9:93948496-93948518 TTTTTTAGGTGAAAAGCCAGGGG + Intergenic
1057915269 9:99050563-99050585 ATTTCTGTGAGAAAACCCAGTGG + Intronic
1058781027 9:108335736-108335758 GACTCTCTGGGAAAAGCAAGTGG + Intergenic
1185678280 X:1866579-1866601 GTTGCAATGGAAAAACCCAGCGG - Intergenic
1186985657 X:15011132-15011154 GTTTTTAGGGGAAATGCTAGAGG - Intergenic
1188033944 X:25295925-25295947 GTTTCTATAGGTAAAACTAGGGG - Intergenic
1189367716 X:40401986-40402008 GTTTCTATGGTAGAAGACAAAGG + Intergenic
1191991851 X:67046437-67046459 GTTTTTCTGGGAAAAGCCTAGGG + Intergenic
1198166873 X:134066487-134066509 GCTACCATGGGAAAAGGCAGTGG + Intergenic
1198599864 X:138270837-138270859 GAGTATATGGGGAAAGCCAGAGG + Intergenic
1199012911 X:142778188-142778210 GATACTGTGGGGAAAGCCAGTGG + Intergenic
1199910487 X:152281551-152281573 GTTTCTAAGGAGAAAGTCAGAGG - Intronic