ID: 917250428

View in Genome Browser
Species Human (GRCh38)
Location 1:173053639-173053661
Sequence CTGTTTAAGAAGAGAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917250422_917250428 20 Left 917250422 1:173053596-173053618 CCTTGATAAACTGAAACCGTTGA No data
Right 917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG No data
917250425_917250428 4 Left 917250425 1:173053612-173053634 CCGTTGAAATAGCGGGTTAGAAA No data
Right 917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917250428 Original CRISPR CTGTTTAAGAAGAGAGAGGA GGG Intergenic
No off target data available for this crispr