ID: 917261601

View in Genome Browser
Species Human (GRCh38)
Location 1:173175342-173175364
Sequence GCCACTGTGTTAGGTGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917261601 Original CRISPR GCCACTGTGTTAGGTGTTCT GGG (reversed) Intergenic
903022285 1:20402786-20402808 GCCACTGTGCTGTGTGATCTTGG + Intergenic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
906003867 1:42451944-42451966 GACCCTGTGTTAGGTGTTACAGG - Intronic
906865694 1:49417028-49417050 CCCACTGTATTCTGTGTTCTGGG + Intronic
906880199 1:49581775-49581797 GCATCTGTGTTGGGAGTTCTAGG + Intronic
908952880 1:69583395-69583417 GCTACTTCCTTAGGTGTTCTTGG + Intronic
912856992 1:113178143-113178165 GCTGGGGTGTTAGGTGTTCTGGG - Intergenic
915941874 1:160123464-160123486 CCCACTGTGTTGGGGGTTCAGGG - Intronic
915968777 1:160336915-160336937 GGCACTGTGTTAGGTGGTAAGGG - Intronic
917261601 1:173175342-173175364 GCCACTGTGTTAGGTGTTCTGGG - Intergenic
917952551 1:180055422-180055444 GCTACTGTGTTAGATGATTTAGG + Intronic
918865059 1:189885361-189885383 GCCACTGTGTAAAGTAGTCTGGG + Intergenic
919468664 1:197952166-197952188 GGCACTGTTTTAGATGCTCTAGG + Intergenic
920829861 1:209454325-209454347 GGCACTGTGCTAGGTGTTTCAGG + Intergenic
920949394 1:210558156-210558178 GGCTCTGTGTTAGGTGTTATGGG - Intronic
1063224211 10:3999965-3999987 TCAACTGTGCTAAGTGTTCTGGG + Intergenic
1064312545 10:14224344-14224366 GTCACTGTGGCAAGTGTTCTAGG - Intronic
1066626205 10:37408282-37408304 GCCACTGCTTTTGGTGTTTTAGG - Intergenic
1067818128 10:49498954-49498976 GCAACTCTGTTGGGTGTTTTTGG - Intronic
1071214717 10:83387470-83387492 GCCACTTTGTTATCTGTTGTTGG + Intergenic
1073029026 10:100509918-100509940 GACACTGTTTTAAGTGCTCTAGG + Intronic
1074542928 10:114380283-114380305 GCAACTGCCTCAGGTGTTCTTGG - Intronic
1076144392 10:128105631-128105653 GCCTCTTCCTTAGGTGTTCTTGG + Exonic
1076918490 10:133439164-133439186 GCCACTGTGTTGGGAGGACTTGG + Intergenic
1079158171 11:17968138-17968160 GGCTCTGTGTTAGGTGCTGTGGG - Intronic
1079434235 11:20429726-20429748 GCAACTGTTTTAAGTGCTCTAGG + Intronic
1081354724 11:42098430-42098452 GCCACTGTGGTAGGTAGTCGAGG - Intergenic
1084482156 11:69428247-69428269 GCCACTGTGTTGGGCTTCCTGGG - Intergenic
1086233899 11:84603794-84603816 GACACTGTGCTAGGTATTGTGGG + Intronic
1092113432 12:5981099-5981121 GGCACTGTGCTAGGTGCTATGGG - Intronic
1092893746 12:12993567-12993589 GCCACTGTGTTAGATACTTTGGG + Intronic
1093897464 12:24590826-24590848 ACCACTGGGTTAGGTGTTAAGGG - Intergenic
1096266774 12:50129841-50129863 GCCACTGGGTGAGCTGTTCACGG - Exonic
1097747829 12:63318690-63318712 GCCAGTGTGATAGCTGTTTTGGG + Intergenic
1101034229 12:100689207-100689229 GTCACTGTGTTCAGTTTTCTGGG + Intergenic
1102059823 12:109923898-109923920 GCCACTGGGCTAAGTGCTCTGGG - Intronic
1104080046 12:125422137-125422159 GGCACTATGTTATGTCTTCTAGG + Intronic
1104135285 12:125931873-125931895 GCCTCTGAGCTAGGGGTTCTGGG - Intergenic
1107037068 13:35912736-35912758 GCCACTGTGATAGCTTTTTTTGG - Intronic
1108293344 13:48985715-48985737 ACCTGTGTGTTAGGTTTTCTGGG - Intronic
1108534761 13:51363358-51363380 GCCACTGTGTTGTGTGATGTAGG - Intronic
1109999194 13:70172807-70172829 GCCACTGTGTTAGACATTGTGGG + Intergenic
1110897071 13:80767767-80767789 GCCACTGTGGTTGGTGTTTTGGG + Intergenic
1116650793 14:47589627-47589649 AACACTGTTTTAGGTATTCTGGG + Intronic
1117747018 14:58879969-58879991 GGCCCTGTGTTAGGTGCTGTGGG - Intergenic
1118689555 14:68324964-68324986 GGCACTGTGTTAGTTGCTGTGGG - Intronic
1123704761 15:22943118-22943140 GCCACTGAGCTGGGTGCTCTCGG + Intronic
1124006604 15:25799918-25799940 TCCACTCTGTTGGGTTTTCTGGG - Intronic
1124816128 15:32994630-32994652 GGCACTGTGCTAGGTGCTCGAGG - Intronic
1125333879 15:38608376-38608398 GCCTCTGTGTGAGGTGTTTCTGG - Intergenic
1125903951 15:43372936-43372958 GAAACTGTGCTAGGTGCTCTGGG - Intronic
1127187459 15:56494123-56494145 GCCACTGTGCTGGGTGCTGTAGG - Intergenic
1129155760 15:73716575-73716597 GACACTGTATCAAGTGTTCTGGG + Intergenic
1136033107 16:27517742-27517764 GCCATTGTGTTCGGTGTTTTCGG + Intronic
1137401125 16:48155221-48155243 GCCACTGTTTTAGGCCTTCTGGG - Intronic
1138700716 16:58860034-58860056 GCCACTGTGTCAGGGGTTGCTGG + Intergenic
1150977841 17:70108968-70108990 GCCACTCACTTAGGAGTTCTAGG - Intronic
1151275722 17:73032668-73032690 GACACAGTTTTTGGTGTTCTAGG - Intronic
1152669289 17:81592279-81592301 TCCCCTGTGTTAGGGTTTCTTGG - Intronic
1153662744 18:7339912-7339934 GCCACTGGGTTCTGGGTTCTGGG - Intergenic
1156584816 18:38420495-38420517 GCCACTGTCTTAGTTGGTTTGGG - Intergenic
1157354500 18:46919919-46919941 GCCACTGTGGGAGGAGTTTTCGG + Intronic
1158154862 18:54414076-54414098 GCCATTGCTTTTGGTGTTCTAGG + Intergenic
1160760065 19:779349-779371 GCCGCTGTGTTCGGTTATCTGGG - Intergenic
1161047757 19:2145383-2145405 ACCACTGCCTTAGGAGTTCTTGG - Intronic
1161774445 19:6251636-6251658 GCCACTGTGCCAGGTCCTCTAGG - Intronic
1162418999 19:10555198-10555220 GCCCCTGTGTTGGGTGCTCTGGG + Intronic
1163429117 19:17256432-17256454 GCCACTGTGTCAGTCTTTCTTGG - Intronic
1163726119 19:18924137-18924159 GCCACTGTGCTAGGTGTCTCAGG + Intronic
1163798780 19:19352744-19352766 GCCCATGTTTTAGGTGTTGTGGG + Intronic
1165069560 19:33247739-33247761 GCCACAGTGGTTGGTGTTGTTGG + Intergenic
1165828500 19:38719053-38719075 GCCACTGTGCTTTCTGTTCTCGG + Intronic
1167759353 19:51435177-51435199 GGCACTGTGTTAGCTAGTCTGGG + Intergenic
1168524972 19:57081511-57081533 TCCACTGTGGGAGGAGTTCTGGG - Intergenic
925023873 2:592951-592973 GCCACCATCTTAGGAGTTCTGGG + Intergenic
925797529 2:7563116-7563138 GGCTCTGTGTTAGGTGCTATGGG - Intergenic
928289972 2:30028497-30028519 GCCACTGTGTTACAAGTTCCGGG - Intergenic
928377725 2:30789704-30789726 GTCACTGTGCTGCGTGTTCTGGG - Intronic
928420739 2:31136567-31136589 GGCAGTGTGTTAGGTGCTATGGG - Intronic
928907222 2:36381029-36381051 CCCACTGTGTTCTGTATTCTGGG - Intronic
929449440 2:42027034-42027056 GCCCCTGAGTGAGGTCTTCTAGG - Intergenic
930548792 2:52804462-52804484 GACATTGTGTAAAGTGTTCTGGG + Intergenic
930988056 2:57613790-57613812 GCCACTGCTTTTGGTGTTTTAGG - Intergenic
931429959 2:62201038-62201060 GGCACAGTGCTAGGTATTCTAGG - Intronic
932168650 2:69532855-69532877 GGCAGTGAGTTAGGAGTTCTAGG + Intronic
932613651 2:73218336-73218358 GGCACTGTGCTAGGTGCTGTGGG + Intronic
933215989 2:79630354-79630376 CCCACTGTTTTAAATGTTCTTGG - Intronic
933701628 2:85259125-85259147 GCCACTGTGTGTGGTGCTGTGGG - Intronic
934636591 2:95994785-95994807 GGCACTGGGCTAGGTGTTCAAGG - Intergenic
936246643 2:110834245-110834267 TCCAGAGTGTGAGGTGTTCTGGG + Intronic
937541079 2:122954557-122954579 GCCACTGAGTTATGTGATCTTGG - Intergenic
939415445 2:141890278-141890300 GCCACTGTGCTAAGTGCTCAGGG - Intronic
940358550 2:152771730-152771752 TACACTGTGTTAGGTATTATAGG - Intergenic
945050223 2:205817113-205817135 GCCACTGTGCTAAGTATTGTGGG - Intergenic
947101183 2:226622689-226622711 GTTACTGTGGTAGGTGTACTGGG + Intergenic
947143113 2:227038103-227038125 GCCACTGCTTTAGGTGTTTTAGG + Intronic
949065399 2:241987285-241987307 GTCACTGCGTTGGGTGTACTCGG + Intergenic
1169594785 20:7185745-7185767 GCCAATGTGTTATGTGTTCCTGG - Intergenic
1171946446 20:31382597-31382619 ACCACTGTGTTAGGTCTACGTGG - Intronic
1172386192 20:34535772-34535794 GCAACTGAGTTAGGTGTTTGTGG - Intronic
1172485067 20:35292923-35292945 TCCACTGTGGTATGTGTTGTGGG - Intergenic
1173803065 20:45906968-45906990 GCCTGTGTGTTAGGTGTGATGGG + Intronic
1174541652 20:51294383-51294405 GCCAATTTGTTAGATTTTCTTGG + Intergenic
1174773495 20:53322884-53322906 GCCTCTGTGTTTGGTGCTCATGG + Intronic
1175607178 20:60320744-60320766 GCCATTGTGCTAGGTGTCCTGGG - Intergenic
950639205 3:14337367-14337389 GCCACTGTGATGGGTGTGCCTGG + Intergenic
951183507 3:19685842-19685864 GCCATTTTGTTAGTTGTTCTTGG - Intergenic
951574780 3:24102479-24102501 GGCACTGTGTTAGGTGCTGTAGG - Intergenic
952463741 3:33557661-33557683 GGCAGTGTGCTAGGTGTTCCTGG - Intronic
954684640 3:52363783-52363805 GCCACAGTGATTGGTGTTCATGG - Intronic
956278013 3:67524527-67524549 GCCAATGTGTTATGTATTCCTGG - Intronic
958758863 3:98282977-98282999 GCCCCTGTTCTTGGTGTTCTTGG + Exonic
959616033 3:108348345-108348367 ATCACTGTTTTTGGTGTTCTTGG + Intronic
959917626 3:111835775-111835797 GTCACTATGTAAGGTGTTCCTGG - Intronic
960070318 3:113423002-113423024 GACAGTGTGTTAGGCATTCTGGG - Intronic
961714251 3:128847819-128847841 GCCACTGGGCTGGGTGTGCTGGG + Intergenic
961912170 3:130329248-130329270 TACACAGTGTTAGGTTTTCTTGG - Intergenic
962053336 3:131842355-131842377 TCCACTGTGCTAAGTGGTCTTGG - Intronic
962961007 3:140310902-140310924 GCCTCTGTGTTAGGTGCTGCAGG + Intronic
963941551 3:151100849-151100871 TCCACTGTGTTAGGTGATATGGG + Intronic
964749345 3:160039993-160040015 CCCACTGAGTTAAGTGATCTGGG - Intergenic
964963354 3:162456744-162456766 GCCATTGTTTTTGGTGTTTTAGG - Intergenic
965514664 3:169608193-169608215 GCCACTGGTGCAGGTGTTCTAGG - Intronic
966330727 3:178810112-178810134 GGCTCTGTTTAAGGTGTTCTTGG + Intronic
966525254 3:180912751-180912773 GCCACTTTGTCGAGTGTTCTGGG + Intronic
967250376 3:187531475-187531497 GGCACTGTGATAGGTGTGGTGGG + Intergenic
968623661 4:1616024-1616046 GCCACTGTGTGAGAGATTCTGGG + Intergenic
972661549 4:41121598-41121620 GCCACCGTGTTGTGTGTTCTGGG + Intronic
978337175 4:107681845-107681867 GTCAGTGTGTGAGGTGTTGTGGG - Intronic
978674412 4:111293623-111293645 GCCATTGCTTTTGGTGTTCTAGG - Intergenic
979135951 4:117113536-117113558 GCCACTATCTTGGGAGTTCTGGG - Intergenic
980234120 4:130081430-130081452 TCCACTGTTTTAGTTGTTCTTGG + Intergenic
980893780 4:138841560-138841582 GCCTCTGTGTTAGGTGCCCCAGG - Intergenic
985542379 5:492889-492911 GCCCCTGGGTGGGGTGTTCTAGG + Intronic
986947070 5:13035117-13035139 AACACTGTGTTGGCTGTTCTAGG - Intergenic
989712827 5:44421468-44421490 GCCACTGGGTTAGATTATCTAGG + Intergenic
991492554 5:67197071-67197093 GCCACTTTCTTAGTTGTCCTAGG + Intergenic
998223222 5:140305067-140305089 TGCACTGTGACAGGTGTTCTAGG - Intergenic
999600661 5:153260259-153260281 GCCACTGTATTACATGTTTTTGG - Intergenic
1002484091 5:179523038-179523060 GCCTCTGTGTGAGGTGCTCTGGG + Intergenic
1002500474 5:179644443-179644465 GCCTCTGTGTGAGGTGCTCTGGG - Intronic
1003528814 6:6920640-6920662 TCCACTGTGTTGGGAGTACTGGG + Intergenic
1004484899 6:16057270-16057292 GCCACTGTGGAAGGTGCTATAGG - Intergenic
1005676515 6:28161079-28161101 GCCACTTGGTTAGGTTTCCTGGG + Intergenic
1006512275 6:34528147-34528169 GGCACTGTGTTAGGTGGTGCAGG - Intronic
1006803050 6:36771612-36771634 GGCACTGTGTTGGGTGCTGTGGG - Intronic
1006973426 6:38071809-38071831 AGCAGTGTGCTAGGTGTTCTGGG - Intronic
1008952576 6:57176592-57176614 GCCACTGTGTTATAAGTTTTGGG - Intronic
1011728894 6:90239516-90239538 GCCACCCTGTAAGGTGTTATAGG + Intronic
1013155196 6:107486801-107486823 GTCTCTGAGTTAAGTGTTCTTGG + Intergenic
1013950219 6:115771191-115771213 GCCAGTGTGACAGTTGTTCTGGG + Intergenic
1017979355 6:159386072-159386094 GCCACTGTGTTAGGAGGTTGTGG + Intergenic
1022289076 7:28983983-28984005 GCAAGTGGTTTAGGTGTTCTGGG + Intergenic
1022817029 7:33923614-33923636 GCCACTGTGCCAGGTATTTTAGG - Intronic
1023354957 7:39357328-39357350 GGCACTGTCCTAGGTGTTTTGGG + Intronic
1024498962 7:50080877-50080899 GCCGCTGTGCTAGGTTTTATGGG - Intronic
1025570224 7:62552988-62553010 GCCATTGTTTTTGGTGTTTTAGG - Intergenic
1027465574 7:78510977-78510999 GCCACTGTGTTGGATGTGGTGGG + Intronic
1028845606 7:95476191-95476213 GACACTGTGATAGGTGTAGTAGG - Intergenic
1029521383 7:101064867-101064889 GGCACGGTGTTAGGTGCTGTGGG - Intergenic
1032022490 7:128416729-128416751 GGCACTGTGCTAGGTGTTAGAGG + Intergenic
1032847172 7:135761706-135761728 GACACTGAGTTTGGTGTTATTGG - Intergenic
1033771071 7:144552589-144552611 GCCAGCATGTTAGATGTTCTAGG + Intronic
1034716918 7:153251984-153252006 GTCACTGAGTTAGGGGTTGTGGG - Intergenic
1036599713 8:10249069-10249091 GCCACTCTCTTGGGTGTTCTGGG + Intronic
1037487050 8:19357513-19357535 GCCTCTATGTTAGATCTTCTGGG - Intronic
1039923196 8:41907199-41907221 AGCACTGTGCTAGGTGCTCTGGG - Intergenic
1040820323 8:51548747-51548769 TCCACTGTGTTATGTTTTATAGG - Intronic
1042073346 8:64960657-64960679 GCCATTGCTTTAGGTGTTTTAGG - Intergenic
1043060362 8:75492731-75492753 GCCACTGTGTAAGGTCAGCTGGG - Intronic
1043309239 8:78837782-78837804 GCCACTGTTTTTGCTGATCTGGG + Intergenic
1044212107 8:89562109-89562131 CACATTGTGTTAGATGTTCTAGG - Intergenic
1046183732 8:110686276-110686298 GCCACTGTGCTAGGTGCTGTGGG + Intergenic
1046273357 8:111925110-111925132 GCCTCTGTGTTAGTTATCCTTGG - Intergenic
1046743724 8:117855175-117855197 GCCACTTAGTTTGGTGTTTTAGG - Intronic
1046773986 8:118144445-118144467 GGCACTGTGCTAGGTGCTTTGGG - Intergenic
1047009092 8:120651831-120651853 TCCACTCTGTTAGGTATTTTTGG - Intronic
1048937688 8:139370526-139370548 GACAGTGTGTGAGGTGTTTTAGG - Intergenic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1050899614 9:10929953-10929975 GCCACTTTGTTAGATGTGATGGG - Intergenic
1053300749 9:36947762-36947784 GCCAAAGTGTGAGGTGTGCTGGG - Intronic
1053377828 9:37623134-37623156 GACACTGTGTTAGGTGCTGAGGG + Intronic
1053528937 9:38858904-38858926 CCTACTGTGTTCTGTGTTCTAGG + Intergenic
1054201165 9:62083339-62083361 CCTACTGTGTTCTGTGTTCTAGG + Intergenic
1054637194 9:67505025-67505047 CCTACTGTGTTCTGTGTTCTAGG - Intergenic
1055774018 9:79748443-79748465 GGCACTGTACTAGGTGTACTAGG + Intergenic
1056136685 9:83636224-83636246 GCCACTGTTGTAGGTGCTTTTGG - Intronic
1060652752 9:125343697-125343719 GGCACTGTGCTAAGTGTTGTGGG + Intronic
1061387001 9:130296274-130296296 GGCACTGTGCTAGGTGTTGCAGG + Intronic
1061841094 9:133359042-133359064 GCCAGTGTGTTAGCTGCTCAGGG + Intronic
1186380083 X:9048807-9048829 GCCACTATGTTACATGTTTTAGG + Intronic
1187143478 X:16616540-16616562 GCCTCTAGGTTAGGTGCTCTGGG - Intronic
1187697645 X:21937837-21937859 GACACTGTGTCAGGTGGTTTTGG + Intergenic
1189205412 X:39234129-39234151 GCCCCTGGATTAGGTGTTCATGG - Intergenic
1189863003 X:45292438-45292460 GGCACTGTGCTAGGTGCTTTGGG + Intergenic
1194072937 X:89350387-89350409 ATTACTTTGTTAGGTGTTCTAGG + Intergenic
1194986507 X:100495546-100495568 GCCACTGTGCTAAGTGTTGTGGG + Intergenic
1195922537 X:109998043-109998065 GCCACTCTGCTAGGTGCTGTGGG + Intergenic
1197638614 X:128943718-128943740 GCCATTGCTTTAGGTGTTTTAGG + Intergenic
1197728527 X:129792268-129792290 GGCACTGTCTCAGCTGTTCTAGG + Intronic
1198432994 X:136586660-136586682 TCCTCTGTGTTAGGTGTTGGAGG + Intergenic