ID: 917262776

View in Genome Browser
Species Human (GRCh38)
Location 1:173187943-173187965
Sequence CTGAAAAAGAGGACCACTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 7, 3: 10, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917262770_917262776 30 Left 917262770 1:173187890-173187912 CCACAATTCAGTAATTCTTGCTT 0: 1
1: 0
2: 1
3: 23
4: 279
Right 917262776 1:173187943-173187965 CTGAAAAAGAGGACCACTTATGG 0: 1
1: 0
2: 7
3: 10
4: 163
917262773_917262776 3 Left 917262773 1:173187917-173187939 CCAGTCCAGAGGGACATACTTTT 0: 1
1: 0
2: 1
3: 11
4: 103
Right 917262776 1:173187943-173187965 CTGAAAAAGAGGACCACTTATGG 0: 1
1: 0
2: 7
3: 10
4: 163
917262774_917262776 -2 Left 917262774 1:173187922-173187944 CCAGAGGGACATACTTTTGAACT 0: 1
1: 0
2: 1
3: 11
4: 119
Right 917262776 1:173187943-173187965 CTGAAAAAGAGGACCACTTATGG 0: 1
1: 0
2: 7
3: 10
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917262776 Original CRISPR CTGAAAAAGAGGACCACTTA TGG Intronic
901595160 1:10379332-10379354 CTGAATAAGAAGGCCTCTTAGGG + Intronic
904655261 1:32040815-32040837 CTGAAAAAGAGGAGCCCCTTAGG + Intronic
905503454 1:38457286-38457308 CTGAGCAAGAGGATCTCTTAGGG + Intergenic
909259155 1:73464708-73464730 TTGAAAGAGAGAAGCACTTATGG + Intergenic
909397512 1:75187164-75187186 CTGAACCAGAGCACCACTTGAGG + Intergenic
910108266 1:83654520-83654542 CTGAAACAGAGGAAGAATTATGG - Intergenic
913693512 1:121301762-121301784 CTGGAAAAGAAGTCCACTTCTGG + Intronic
914144044 1:144978318-144978340 CTGGAAAAGAAGTCCACTTCTGG - Intronic
914962834 1:152221263-152221285 CTGAAAAAGAGGAGAACAAACGG - Exonic
915859087 1:159422812-159422834 GTGAAAATGAGGACCACTGGGGG + Intergenic
917145291 1:171884273-171884295 CTGATAAAAAGAACCACTTCAGG - Intronic
917262776 1:173187943-173187965 CTGAAAAAGAGGACCACTTATGG + Intronic
919161700 1:193838993-193839015 CTGAAAAGGAGGACAGATTAAGG + Intergenic
920480836 1:206320131-206320153 CTGGAAAAGAAGTCCACTTCTGG + Intronic
1064307174 10:14177773-14177795 CTGTATAAGTGCACCACTTAGGG + Intronic
1065210086 10:23394623-23394645 AAGGAAAAGAGGAGCACTTAGGG - Intergenic
1066027550 10:31377733-31377755 CTGAAAATGAGGCACACTAAAGG - Intronic
1068282353 10:54890852-54890874 CAGAGAAAGAGGACAACTTTAGG - Intronic
1069027588 10:63560495-63560517 ATGAAAAATAAAACCACTTATGG - Intronic
1069291603 10:66786882-66786904 ATGAAAAGGAGGACAACCTAAGG + Intronic
1070495955 10:77022732-77022754 GTGAAAAAAAGGAAAACTTATGG - Intronic
1071202060 10:83230061-83230083 CTTAAACAGAGGTCCTCTTAAGG - Intergenic
1076273511 10:129176829-129176851 CTGTAATAGAGGACCATTTTGGG - Intergenic
1080105025 11:28502797-28502819 GTGAAAAAGAGCAGAACTTATGG + Intergenic
1080953903 11:37069916-37069938 CTGAAAAAGAGAACTATGTAGGG - Intergenic
1081871449 11:46384424-46384446 CTGAATACGTGGACCACTCACGG + Intergenic
1081961049 11:47137808-47137830 ATGAAAAAAAGGAGCATTTAGGG + Intronic
1084898891 11:72295041-72295063 CTGAAAAAAAGGAGCACATCCGG - Intronic
1085160857 11:74343035-74343057 CTAGAAAAGAGGAAAACTTAAGG + Intronic
1087425300 11:97978117-97978139 TTCAAAAAGAGGTCCATTTATGG + Intergenic
1091264535 11:134260421-134260443 GTGAGAAAGAGGTACACTTAGGG - Intronic
1094280358 12:28730492-28730514 CTGTAGGAGAGGACCACTGATGG - Intergenic
1095482414 12:42650072-42650094 CCAAAAAAGAGGACAACTTGAGG - Intergenic
1098513119 12:71342221-71342243 CTGAGAAACAGTAGCACTTAGGG - Intronic
1101092325 12:101300325-101300347 ATGAAAAAGAGGACCTGGTATGG - Intronic
1103842875 12:123879610-123879632 TTGAAACAGAAGCCCACTTAAGG - Intronic
1104073944 12:125373004-125373026 TTGCCAAAGAGGACCACATAGGG - Intronic
1106712580 13:32353824-32353846 CTGAGAAAGATGATCACTTTTGG + Intronic
1107818581 13:44266320-44266342 ATGAAAAAGAGCACCACTGCAGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1109093854 13:58085743-58085765 ATGAAAAAGAAGACCAGTTTGGG + Intergenic
1110127798 13:71968900-71968922 CTGAAAAAAAGGAGTAATTATGG + Intergenic
1110243967 13:73300510-73300532 CTGAAAACCAGGAACACTGATGG - Intergenic
1111822800 13:93233892-93233914 GTGAAAAAGGGAACAACTTACGG - Intronic
1112654456 13:101435204-101435226 CTGAAAAAGAGGGCCTTATAAGG + Intergenic
1113063529 13:106350775-106350797 CTGAAAAATGGGATCAATTATGG + Intergenic
1113311283 13:109135595-109135617 CTGAACAAGAGAATCACTTCAGG - Intronic
1116193992 14:41698562-41698584 CTGCACAAGAGAACCACCTAGGG - Intronic
1116870725 14:50067154-50067176 CTGAAAGAGAGTCCCTCTTAGGG + Intergenic
1125075887 15:35617804-35617826 TTGAAAAAGAGGACAGCTGAAGG + Intergenic
1125843768 15:42831650-42831672 CTGTAAAAGAAGAGCACTTTGGG - Intronic
1125982810 15:44018499-44018521 CTGAAAAAAAGTATCACTTTGGG + Intronic
1126446007 15:48745398-48745420 CTGAAAAAGACACCTACTTAAGG - Intronic
1127981381 15:64037778-64037800 CTGGAAGAGAGGACCTCTAAAGG + Intronic
1128729702 15:70012968-70012990 CTGGGAAAGAGGGCCATTTAAGG - Intergenic
1129959610 15:79671946-79671968 CTGCAAAAGAGGACAACTTATGG - Intergenic
1130293212 15:82622912-82622934 CTTATAAAGAGGATCACATAAGG - Intronic
1130333685 15:82940945-82940967 CTGTAAAAGAGGAAAACATATGG - Intronic
1130517381 15:84636463-84636485 CTGAAAAACAAGGCCAGTTATGG + Intergenic
1133522045 16:6568052-6568074 CTTAAATAGTGGACCACTTCAGG - Intronic
1140594682 16:76395021-76395043 CTGAAAAAGAGGAATGTTTAAGG - Intronic
1146482284 17:33214294-33214316 CTGAAAAAGAGGAGCATCTTGGG - Intronic
1148948612 17:51288436-51288458 CTGAAAATGAGGACCACTTTAGG - Intronic
1203166873 17_GL000205v2_random:105523-105545 CTGCAAAAGGGGGCCACTGAAGG + Intergenic
1153179715 18:2419422-2419444 CTGAAAAAGAACACTTCTTATGG + Intergenic
1158740322 18:60134656-60134678 CTGAAAAAAACAACAACTTAGGG - Intergenic
1167888653 19:52522582-52522604 CTGAAAAAGGAGACCAATAAAGG + Intergenic
924963327 2:54564-54586 ATGAGAAAGAGGACTATTTATGG - Intergenic
927695303 2:25235724-25235746 ATGAGAAAGAGGACATCTTATGG - Exonic
931357621 2:61550861-61550883 GAGGAAAAGAGGACCACTAAAGG + Intergenic
932624792 2:73288885-73288907 TTGAAAAAGAGGAGCAAATAAGG + Intergenic
937140266 2:119594215-119594237 ATGAAAAAGAGGACAACCTCAGG - Intronic
937782818 2:125858833-125858855 CTGAAAATGAGAAGCACTTTAGG + Intergenic
938505261 2:131873454-131873476 CTGCAAATGAGGACAATTTATGG - Intergenic
939604086 2:144230954-144230976 CTAAAAAAGAGGAACTCATATGG + Intronic
942929535 2:181473112-181473134 CTGACCATGAGAACCACTTAGGG + Intronic
944968569 2:204964899-204964921 CTGAAAAATAGAACCAATTTTGG - Intronic
948882001 2:240863719-240863741 TTGAAAAAGAGGATCTCTTAAGG - Intergenic
1170087622 20:12552525-12552547 CTGGATAAGAGGAGCACATAAGG + Intergenic
1170771229 20:19334499-19334521 GTGAAAAAGATGATCACTTATGG - Intronic
1170778047 20:19396077-19396099 CTTGAAAAGATGACCATTTATGG + Intronic
1171954760 20:31452715-31452737 CTGTGAAAGAGGACTACATAAGG + Intergenic
1172233999 20:33357394-33357416 CTGAAAAAGAGGTCCACTGGTGG + Intergenic
1174746658 20:53069903-53069925 CCTGGAAAGAGGACCACTTAGGG + Intronic
1175057111 20:56208633-56208655 TTGGACAAGAGGACCACTTGGGG - Intergenic
1175979892 20:62733296-62733318 CTGAAAATTAGCACCAATTAGGG + Intronic
1176334690 21:5585034-5585056 CTGCAAAAGAGGACCACTGAAGG - Intergenic
1176393067 21:6235914-6235936 CTGCAAAAGAGGACCACTGAAGG + Intergenic
1176404882 21:6353574-6353596 CTGCAAAAGGGGGCCACTGAAGG - Intergenic
1176432275 21:6635530-6635552 CTGCAAAAGGGGGCCACTGAAGG + Intergenic
1176468352 21:7080260-7080282 CTGCAAAAGAGGACCACTGAAGG - Intronic
1176491913 21:7462038-7462060 CTGCAAAAGAGGACCACTGAAGG - Intergenic
1176508729 21:7676345-7676367 CTGCAAAAGAGGACCACTGAAGG + Intergenic
1177920151 21:27142800-27142822 CTGGATAAGCTGACCACTTAAGG - Intergenic
1181037733 22:20178051-20178073 CTGGAAAACAGGACCCCTGAAGG - Intergenic
1183818250 22:40322072-40322094 CTGAGAAAGAGCAGCACTTCCGG + Intronic
953065208 3:39462917-39462939 CAGATAAAGAGGACAACTTTTGG + Intergenic
955763678 3:62317633-62317655 CTAGAACAGAGGACCACTCAAGG + Intergenic
956045098 3:65187666-65187688 TTGAACAAAAGGATCACTTAAGG - Intergenic
958913143 3:100017799-100017821 CTGAAAACCAGGAGCACTGAAGG - Intronic
960707615 3:120495518-120495540 CTGGAATAGACGACCCCTTATGG + Intergenic
963590739 3:147255134-147255156 ATGAAAAAAATGTCCACTTACGG + Intergenic
964305081 3:155331137-155331159 CTGAAATAGTGGATCACTTTTGG - Intergenic
964685280 3:159388618-159388640 GTGAAAAAGAGGAACATTGAGGG + Intronic
964711742 3:159678211-159678233 GTGAAAAATAGGACAATTTATGG - Intronic
968047020 3:195630217-195630239 CTGAGCAAGACGACCACTCAGGG - Intergenic
968307631 3:197659827-197659849 CTGAGCAAGACGACCACTCAGGG + Intergenic
968558928 4:1266094-1266116 CTGAGATAGAGGATCACTTGAGG + Intergenic
970550166 4:17172172-17172194 ATGAAAAAGGCCACCACTTACGG - Intergenic
974432391 4:61816172-61816194 TTGAAAAAGAGTACTACTTTAGG + Intronic
975876415 4:78842935-78842957 TAGAAAAAGAGACCCACTTATGG - Intronic
979382034 4:120018654-120018676 CTGAGAAAGATTACCAGTTATGG - Intergenic
979981515 4:127261891-127261913 TTGAAAAAGAGGAATATTTAAGG + Intergenic
982121897 4:152150862-152150884 CTCAAAAAGAGGTCATCTTAGGG - Intergenic
982230653 4:153205514-153205536 CTGAAAAAAAGAATCACCTACGG + Intronic
984671581 4:182495183-182495205 CAGAAAGAGAAGAGCACTTAAGG - Intronic
985401370 4:189597570-189597592 CTGAAAAGGAGGAGCTCTTGCGG - Intergenic
985744600 5:1638927-1638949 CTGAGCAAGACGACCACTCAGGG + Intergenic
986038434 5:3962945-3962967 ATGAAAGAGAGTACCACTTCAGG + Intergenic
986416954 5:7538350-7538372 CGGTAAAAGAGGACCAATAATGG + Intronic
986598874 5:9451405-9451427 CTGAAAAAGAGAAGCAGTAAAGG - Intronic
988173687 5:27692930-27692952 CTGAATAAGAGGCCCATGTATGG - Intergenic
988564344 5:32309055-32309077 CTGAAAAATGTGACCACTTCAGG + Intronic
989454626 5:41628793-41628815 TTGAAATAGAGGACCACGGAAGG + Intergenic
994069672 5:95586585-95586607 CTGACAAAGGTGACCACTTTGGG - Exonic
994260656 5:97654954-97654976 CTGAAAAAGAGGAGGATTTAGGG - Intergenic
998427286 5:142039635-142039657 CTGAGAAGGAGGAACACATAGGG - Intergenic
998930437 5:147175429-147175451 ATGAAAAAGAGGACCAGAGAAGG - Intergenic
1001185719 5:169569759-169569781 CTGACTAAGTGGCCCACTTAGGG + Intergenic
1001693339 5:173649274-173649296 GTGCAAAATAGGACCACATATGG + Intergenic
1001880245 5:175237258-175237280 CTCAAAAAGAGGACTACAAAGGG - Intergenic
1006291649 6:33142468-33142490 CTGAACAGGAGGATCACTTGAGG + Intergenic
1006756266 6:36418327-36418349 CTGGAAAACATGACCAATTAAGG + Intronic
1008152975 6:47977574-47977596 CTGAAACAGAGGACTCATTATGG + Intronic
1010121792 6:72384559-72384581 CTGAATAGGAGGACCTTTTAAGG - Intronic
1011795044 6:90943723-90943745 GTGAATAAGTGAACCACTTAGGG + Intergenic
1012317847 6:97801899-97801921 CTGAAAAAAAGGTAGACTTAAGG - Intergenic
1012564574 6:100631881-100631903 CTGAAAAGTAGGAAAACTTAGGG + Intronic
1012953790 6:105546861-105546883 CTCAAAAGGACCACCACTTAAGG - Intergenic
1013581479 6:111539068-111539090 ATGAAAAATAGGAACACTTTTGG - Intergenic
1014632693 6:123805354-123805376 CTGATAAACAAGAACACTTAAGG - Intronic
1017938428 6:159028022-159028044 CTAGAAAAGAGGAGCAATTATGG - Intergenic
1018321919 6:162620251-162620273 CTGAAAAAGATGTTGACTTAAGG - Intronic
1021673675 7:23059076-23059098 CTGAATAATAGGAACAGTTATGG - Intergenic
1022175588 7:27869201-27869223 CTGAAAAACAGGAACAGTCATGG + Intronic
1024176226 7:46843793-46843815 CAGAAAAAGATTTCCACTTAAGG - Intergenic
1026538357 7:71259144-71259166 ATGAAAAAGAGGCCCTCTGAAGG - Intronic
1027630868 7:80603930-80603952 CTGATTAAGATGACTACTTAAGG + Intronic
1037036280 8:14172085-14172107 CTGAAAAAGATGACCAGATAAGG + Intronic
1037425624 8:18751403-18751425 CAGAAAAAGAGAACAACTTCTGG + Intronic
1037426113 8:18756681-18756703 CAGAAAAAGAGAACAACTTCTGG + Intronic
1037626985 8:20616900-20616922 CTGAGACAGAGGATCACTTAAGG - Intergenic
1037666885 8:20977504-20977526 CTGAAAAATAGAACCGCTTAGGG + Intergenic
1037755275 8:21706288-21706310 CTGACAAAAAGGACCCCTCAAGG + Intronic
1039144392 8:34429885-34429907 CTGAAAAAGAAGATCCCATATGG - Intergenic
1039899834 8:41743599-41743621 CTGAGAAAGAGGACAGCTAATGG + Intronic
1044149591 8:88758980-88759002 CTGAAAAACAGGAGCATTGAGGG - Intergenic
1046404240 8:113751726-113751748 CGAAGAAAGAGGACCAGTTAAGG + Intergenic
1046624313 8:116560626-116560648 AAGAAAAAGAGGAGCACTTAGGG + Intergenic
1048485913 8:134847560-134847582 CTGAAAAAAGGCACCACTCAAGG - Intergenic
1048614200 8:136056635-136056657 CTTAAACAGAGGACCCCTGAAGG - Intergenic
1050564716 9:6870170-6870192 CTGAAAAAAACAACCACTTCAGG + Intronic
1051072813 9:13193398-13193420 GTGAGAAAGATGACCACTTTTGG - Intronic
1051154737 9:14128769-14128791 CTGGAGAAGAGGATCAATTAAGG + Intronic
1051586232 9:18729784-18729806 CTTAAGAAGAGCAGCACTTAAGG - Intronic
1053826580 9:42030879-42030901 CTGACCAAGGGGACCACATAGGG + Intronic
1054603980 9:67156544-67156566 CTGACCAAGGGGACCACATAGGG - Intergenic
1058356591 9:104090743-104090765 CTGAAGAAGAGCACCACATGAGG + Intergenic
1060058804 9:120440185-120440207 CTGAGGAAGAGGACAACTGAGGG - Intronic
1203426948 Un_GL000195v1:49886-49908 CAGCAAAAGAGGACCACTGAAGG + Intergenic
1203439263 Un_GL000195v1:173182-173204 CTGCAAAAGGGGGCCACTGAAGG - Intergenic
1187637718 X:21250539-21250561 CTGAAAAAGAGGAACTCCAAAGG - Intergenic
1187897281 X:23994154-23994176 CTGACAAAGTGGACCACATCTGG + Intronic
1189392858 X:40591627-40591649 TTGAAAAAGAGAGCCACTAAAGG + Intronic
1191815557 X:65241029-65241051 CAGAATTAGAGGCCCACTTAAGG + Intergenic
1191953246 X:66617252-66617274 ATGAAAAAAAGGTGCACTTATGG - Intronic
1192448756 X:71229624-71229646 CTAAAAAAAAAGACCAGTTATGG + Intergenic
1196053178 X:111327095-111327117 CTGCTAAAGAGGAGCACTTTTGG + Intronic
1196989959 X:121317418-121317440 CTGAAAATGAAGGACACTTATGG + Intergenic
1197177559 X:123501581-123501603 CTGGAAAAGATGACCAGTTATGG - Intergenic
1200301376 X:154979958-154979980 GTGAAAATGAGGAACACTAAGGG + Intronic