ID: 917263781

View in Genome Browser
Species Human (GRCh38)
Location 1:173197674-173197696
Sequence CTGTTGCAGGGGCAAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 1, 1: 0, 2: 7, 3: 65, 4: 588}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917263781 Original CRISPR CTGTTGCAGGGGCAAGGGGA GGG Intronic
900151453 1:1180913-1180935 CGGGTGCAGGGGCAGGGGCAGGG - Intronic
900151475 1:1180960-1180982 CAGGGGCAGGGGCAAGGGCAGGG - Intronic
900151499 1:1181018-1181040 CAGGGGCAGGGGCAAGGGCAGGG - Intronic
900323448 1:2095968-2095990 CTGTGCCAGGGGCCAGGGCAGGG + Intronic
900578259 1:3394684-3394706 TTGTAGCAGGCGCAAGTGGAAGG - Intronic
900929325 1:5726364-5726386 CAGCTGCAGGAGCAAGGGGCAGG + Intergenic
900929432 1:5726920-5726942 CAGCTGCAGGAGCAAGGGGCAGG - Intergenic
900989002 1:6089335-6089357 CTGTGGCAGAGGCATGGGGCAGG - Intronic
902042768 1:13504716-13504738 GTGTTGAAGGGGGGAGGGGAGGG + Intronic
902077753 1:13801170-13801192 CTATGGAGGGGGCAAGGGGAGGG + Intronic
902384934 1:16071160-16071182 CTGGTGCAGGGGCCAGGTGGGGG + Intronic
902602513 1:17549954-17549976 CATTTGCAGGGTCAAGGGCAGGG + Intronic
902700461 1:18168635-18168657 ATGTTGCAAGGGGCAGGGGATGG + Intronic
903331260 1:22598232-22598254 CTCTTGCATGGGCTTGGGGAGGG + Intronic
903422630 1:23229466-23229488 CAGCTGCAGGGAGAAGGGGATGG + Intergenic
904442441 1:30540535-30540557 CTGTGGCAGGGCCAAAGGGAAGG + Intergenic
905015223 1:34773499-34773521 CTGGGTCGGGGGCAAGGGGAGGG + Intronic
905183328 1:36179423-36179445 CTGCGGCCCGGGCAAGGGGAGGG + Intronic
905228063 1:36492869-36492891 CTGTGGCAGGAGGATGGGGATGG + Intergenic
905274383 1:36807544-36807566 CTGGGGCATGGGCAGGGGGATGG + Intronic
905295695 1:36953188-36953210 ATGAGGCAGGGGCAGGGGGAGGG - Intronic
906489272 1:46255425-46255447 CTATAGCAGGGGGCAGGGGAGGG - Intronic
907239994 1:53075996-53076018 CTCGGGCTGGGGCAAGGGGAGGG + Intronic
907306793 1:53517794-53517816 CCGGGGCAGGGGCAAGGGCAGGG - Intronic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
908766140 1:67556186-67556208 GTGTAGCAGGCGCAAGGGGCGGG + Intergenic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909463723 1:75948692-75948714 CTGTTTCAGGGAGAAGGGAATGG + Intergenic
909492649 1:76242602-76242624 CTGTTGCAGGGTGAGGGGAAAGG - Intronic
909731355 1:78895324-78895346 CTGGTGCAGTGGCAAGGGCTAGG + Intronic
910764304 1:90765572-90765594 CTGTTGGAAGGGCAGGGTGAGGG - Intergenic
912092657 1:106100417-106100439 GTGTTGGAGGGGCAGGGGCAGGG - Intergenic
912607226 1:111003542-111003564 GAGGTGGAGGGGCAAGGGGAGGG + Intergenic
912800273 1:112715545-112715567 CTGTTGCTGTGGGAAGGGGGCGG + Intergenic
912985105 1:114419755-114419777 CTCTTACAGGAGCAGGGGGATGG + Intronic
913069485 1:115286033-115286055 GTGTAGAAGGGGCAGGGGGAGGG + Exonic
913106343 1:115617172-115617194 CATTTGCAGGGGAAGGGGGATGG + Intergenic
915515532 1:156410345-156410367 CTGATGTCGGGGCAGGGGGATGG - Intronic
917084767 1:171294379-171294401 CTGTTGCAGGGGCTTGTGCAGGG + Intergenic
917263781 1:173197674-173197696 CTGTTGCAGGGGCAAGGGGAGGG + Intronic
917459205 1:175214573-175214595 CTGTGGCAGGGGACAGGGGTGGG + Intergenic
917631168 1:176892997-176893019 CTGGTGCAGGGAGAAAGGGAAGG + Intronic
917790565 1:178496392-178496414 CTGATGCAGGTGGGAGGGGAGGG - Intergenic
917818373 1:178734394-178734416 CAGTAGCAGGGGTAAGGGGGTGG + Intronic
917874844 1:179277087-179277109 CTCTTGCAAAGGGAAGGGGAGGG - Intergenic
917890825 1:179436692-179436714 AGGGTGCAGGGGCAAGGGGAAGG + Intronic
917964217 1:180168261-180168283 CTGTGGGAGGGGCACTGGGAGGG + Intronic
919804956 1:201376008-201376030 CTGATGCAGGGGAAAGAGGTGGG + Intronic
919931107 1:202222163-202222185 CTGGTGCCAGGGGAAGGGGAAGG - Intronic
919983762 1:202658796-202658818 CACTGGCAGGGGCAAGAGGAGGG - Intronic
920452191 1:206067882-206067904 CTGTTGCAGGTGCAACTGGCTGG - Intronic
920560747 1:206936736-206936758 CTTGTTCAGGGGCCAGGGGAGGG + Intronic
920913381 1:210237807-210237829 ATGTTTCAGGGTAAAGGGGAGGG + Intronic
922076918 1:222254067-222254089 CTGTTGCAGCATCTAGGGGAGGG - Intergenic
922390097 1:225132355-225132377 CTGTTGTGGGGGCAGAGGGAGGG - Intronic
922586257 1:226736914-226736936 CTGCGGAAGGGGCACGGGGAGGG + Exonic
922703784 1:227778311-227778333 CTGATGCAGGGGCTAGTGGGAGG + Intronic
923712141 1:236395910-236395932 CTGCGGCATGGGCAGGGGGAAGG - Intronic
924274364 1:242370492-242370514 CTGAGCCAGGGGCCAGGGGAGGG + Intronic
924667337 1:246086875-246086897 CTGTCGGAAGGGCGAGGGGAGGG - Intronic
924736488 1:246761564-246761586 CGGTTGCCGGGGCTGGGGGAGGG - Intronic
1063103592 10:2973332-2973354 CTGAGGCAGGGGCAAGGGGGAGG + Intergenic
1063401653 10:5752094-5752116 CTGCTGCAAGGGTAGGGGGAGGG - Intronic
1063748025 10:8908209-8908231 CTGTTGGGGGCGCAGGGGGAGGG + Intergenic
1063969230 10:11369869-11369891 CTGTTGTAGGGGCAAAAAGAAGG - Intergenic
1064541083 10:16405923-16405945 CTGTTCCCAGGGCAGGGGGAGGG + Intergenic
1065435296 10:25699343-25699365 TTTCTGCAGGGGCAAGAGGATGG - Intergenic
1065789172 10:29243927-29243949 CTGCTGCAGGGACAAGGGCAGGG + Intergenic
1065975807 10:30841441-30841463 CTATAACAGGGGCAAGGGAAGGG + Intronic
1066271383 10:33827540-33827562 CTGTTGGTGGGGCAGGGGGATGG + Intergenic
1067024756 10:42835050-42835072 TGGTTGCAGGGGCTGGGGGAAGG - Intergenic
1067166045 10:43867379-43867401 CTGGGGCGGGGGCAAGGGCAGGG + Intergenic
1067317557 10:45182259-45182281 CTGTTGTGGGGGCAGGAGGAGGG + Intergenic
1067337608 10:45377759-45377781 CTGTTGCTGGGACAGGGAGACGG - Intronic
1067338731 10:45384112-45384134 CTGATGCAGGGGGAGGGGGAAGG + Intronic
1067478119 10:46579293-46579315 CTCTTGGAGGGGCACTGGGATGG + Intronic
1067616621 10:47762494-47762516 CTCTTGGAGGGGCACTGGGATGG - Intergenic
1067659027 10:48219825-48219847 CTGCTGCAGGGGCAAGGGCTTGG + Intronic
1067777506 10:49174244-49174266 CTGAGGCAGGGGCAGGGGCAGGG - Intronic
1069028722 10:63572468-63572490 CTGTTGGAGGGTCAGGGGCAAGG - Intronic
1069091344 10:64202999-64203021 CTATTGCAGGGGCAAAATGAGGG - Intergenic
1069658042 10:70104964-70104986 CTGTGGCAGGGGGTCGGGGAGGG + Intronic
1071568313 10:86682866-86682888 CTGCTGCAAGGGCAAAGGCAAGG - Intronic
1072307381 10:94120696-94120718 CACTTCCAGGGGCAAAGGGAGGG - Intronic
1072743398 10:97923703-97923725 CTGTTGCAGGAGCACGGGGCAGG - Intronic
1073332231 10:102677821-102677843 CTGTTACAGATGCAAGGGGAAGG - Intronic
1073478128 10:103767680-103767702 CGGCAGCAGGGGCAATGGGATGG - Intronic
1073479922 10:103779937-103779959 CTGAAGAAGGGGGAAGGGGAAGG + Intronic
1073735497 10:106341237-106341259 ATGCTACATGGGCAAGGGGAAGG - Intergenic
1074134978 10:110618223-110618245 CTGTGGCAGGGGCCTGAGGAGGG + Intergenic
1074689953 10:115995275-115995297 CTGGTGGAGGGGTAAGTGGACGG + Intergenic
1074852304 10:117448669-117448691 CTGTGGGAGGGGGACGGGGAGGG - Intergenic
1075048269 10:119163401-119163423 TTTTTGCTGGGGGAAGGGGATGG + Intronic
1075198344 10:120380184-120380206 CGGTTTGAGGGGCAAGAGGAGGG + Intergenic
1075269069 10:121033278-121033300 CTGAGGCAGGGGTTAGGGGATGG + Intergenic
1075652021 10:124133561-124133583 CTGGTGTAGTGGGAAGGGGAGGG + Intergenic
1075852687 10:125602038-125602060 GTGTTGCAGGGGGAAAGGGGAGG + Intronic
1076407517 10:130222555-130222577 CTCTGCCAGGGGCAAGGGTAGGG + Intergenic
1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG + Intergenic
1077154698 11:1086067-1086089 CTGTGGCGGGCCCAAGGGGAGGG + Intergenic
1077249468 11:1554615-1554637 CTGCAGAAGGGACAAGGGGAAGG + Exonic
1077703024 11:4459145-4459167 CAGTTGTAGGGGGAAGGTGAGGG - Intergenic
1077738059 11:4812594-4812616 ATGTTGCAGGTGCAAAGGGTTGG + Intronic
1077997451 11:7466276-7466298 ATACTGCAGGGGCAATGGGAAGG - Intronic
1078337700 11:10476926-10476948 CAGGACCAGGGGCAAGGGGAAGG + Intronic
1078514982 11:12014315-12014337 CTGTTGCAGGGGCAGACAGAGGG + Intergenic
1078929291 11:15901133-15901155 CTGGGGCAGGGGCCTGGGGAAGG - Intergenic
1079099773 11:17533914-17533936 CTTGTGCAGGGGCCTGGGGAGGG - Intronic
1079185476 11:18232170-18232192 CTGTTGCAGGGGCTGGGTGCAGG - Intronic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1079385037 11:19971381-19971403 CTTTTTAGGGGGCAAGGGGATGG + Intronic
1079396166 11:20065706-20065728 CAGTGGCAGAGGCATGGGGAAGG + Intronic
1079787641 11:24694926-24694948 CTGTGTAGGGGGCAAGGGGAGGG + Intronic
1080033810 11:27689872-27689894 CTGGAGCAGGGGGCAGGGGAAGG - Intronic
1080597624 11:33788471-33788493 CTGTTGCAGGGTCGGGGAGAGGG + Intergenic
1082674154 11:56075112-56075134 CTGTGGCAGGAGGATGGGGAGGG - Intergenic
1082793189 11:57361440-57361462 CTGTTGGGGGTGCAGGGGGAAGG - Intronic
1082823419 11:57560486-57560508 TTGCTGCTGGGGCAGGGGGAGGG - Intronic
1082983468 11:59145143-59145165 CCTTTCCAGGGGCAAGGGCAGGG - Exonic
1083042599 11:59702107-59702129 CTGTCCGAGGGGGAAGGGGAGGG - Intergenic
1083304679 11:61756182-61756204 CTGTGGGATGGGTAAGGGGAGGG + Intronic
1083369379 11:62166246-62166268 CTGTGTCAGGGCCAAGGAGATGG + Intergenic
1083757117 11:64797588-64797610 CTGGGGGAGGGGCAAGGGGCAGG - Intronic
1083881763 11:65552404-65552426 CTGCTGCAGGGGCCAGTGGGGGG + Exonic
1083887277 11:65579055-65579077 CTGGGGGAGGGGGAAGGGGAGGG - Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085454120 11:76656189-76656211 GGGCTGCAGGGCCAAGGGGAGGG + Intergenic
1086002859 11:82001881-82001903 CTGTTGGAGGGGCAAGAGTGAGG + Intergenic
1087510590 11:99087515-99087537 ATGTTGCAGGAGGAAGTGGAAGG + Intronic
1088494687 11:110421219-110421241 CTGTTGCAGGGGCTTGTGGAGGG - Intergenic
1088624274 11:111717912-111717934 CTGTTAGGGGGGCAATGGGAGGG + Intronic
1089122376 11:116146366-116146388 CTGTTGGAGGGGCAAGAGTGAGG - Intergenic
1089406653 11:118203196-118203218 CTGCTGCTAGGCCAAGGGGAGGG - Intronic
1089685246 11:120142406-120142428 CTTGCCCAGGGGCAAGGGGATGG - Intronic
1089949156 11:122509499-122509521 CTGTTGCTGGAGTTAGGGGAGGG + Intergenic
1090064486 11:123491462-123491484 CTGGTGCTGGGGGAAGGGGAGGG - Intergenic
1090078071 11:123591886-123591908 CTGTAGCAGTGGCAGGGAGAGGG - Intronic
1090333914 11:125950471-125950493 CTGTGGGAAGGGGAAGGGGAAGG + Intergenic
1090396438 11:126422334-126422356 GTGTAGCAGGAGCAAGGGGCAGG + Intronic
1090505393 11:127306936-127306958 TTTTTGAAGGGGGAAGGGGAAGG - Intergenic
1090654924 11:128835902-128835924 CGGTTGCAGGGGCCAGGAGCTGG - Intergenic
1091358562 11:134957109-134957131 CCCATGCAGGGGCAAGGGTATGG - Intergenic
1091583236 12:1801159-1801181 CTGAGGCAGGGGCAGGGGGTGGG - Intronic
1092054749 12:5499540-5499562 CTGTTGTAGGGGCCAGGGATGGG + Intronic
1092116223 12:6009957-6009979 TGGTTGCGGGGGCTAGGGGAAGG + Intronic
1092756533 12:11768723-11768745 CTCTTTCAGAGGCAAGGGCAAGG - Intronic
1092805308 12:12216843-12216865 AGATTGCAGGGGCAGGGGGAGGG - Intronic
1092970911 12:13693801-13693823 CTGTTCCAGAGGCAAGGAAAAGG - Intronic
1093407796 12:18826332-18826354 GAGTAGCAGGGGCAGGGGGAAGG - Intergenic
1094555747 12:31497912-31497934 CAGGGGCAGGGGCAAGGGCAGGG + Intronic
1094746550 12:33350923-33350945 CAGTAGCAGGAGCAAGGGGTGGG + Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1096553398 12:52388951-52388973 CTGGTGGAGGTGAAAGGGGAAGG + Intergenic
1098680191 12:73344510-73344532 CTGTTGCAGGGTGAAGGGCTAGG - Intergenic
1100428680 12:94510774-94510796 TAGTTACAGGGGCTAGGGGATGG - Intergenic
1101036320 12:100710678-100710700 CTGTTGGTGGGGGAGGGGGAGGG + Intergenic
1101083091 12:101208995-101209017 CTGTTTCAGTGGAAAGGGGGTGG + Intronic
1101423496 12:104568331-104568353 CTGTTGCAAGGACAGTGGGAGGG - Intronic
1101683730 12:106995803-106995825 CTGTTGGGGGGGCAGGGGCAGGG - Intronic
1101754853 12:107613441-107613463 ATGTTGCAAGGGGGAGGGGAGGG - Intronic
1101811241 12:108109848-108109870 TTGTTGCTGGGGCAGAGGGATGG + Intergenic
1102730405 12:115103995-115104017 CTGGGGCAGGGCCAAGGGCAGGG - Intergenic
1102928936 12:116847995-116848017 CTGTTGCGGGGGCTGGGGGAGGG - Intronic
1103978626 12:124720987-124721009 CTGTGGAAGGAACAAGGGGAGGG + Intergenic
1104923353 12:132302794-132302816 CTGTGGCAGCAGAAAGGGGACGG + Intronic
1106006439 13:25774403-25774425 CTGTTGGGGAGGCAGGGGGAGGG + Intronic
1106016622 13:25875079-25875101 CAGTTGCCGGGGCTGGGGGAGGG + Intronic
1106443222 13:29799202-29799224 CGGGGGCAGGGGGAAGGGGAAGG - Intronic
1106615461 13:31323097-31323119 CTGTTGCAGGGGACGGAGGAGGG + Intronic
1107814983 13:44236664-44236686 CTACTGCAGGGGAATGGGGAGGG + Intergenic
1108243334 13:48490063-48490085 CTTTTGCAGGGGAAATGGAAAGG + Exonic
1108960062 13:56215377-56215399 TGGTTGCTGGGGCTAGGGGAAGG + Intergenic
1111743505 13:92234780-92234802 CTGGTGCAGGTGGAAGAGGAGGG + Intronic
1111913103 13:94333776-94333798 CTGTTGCAGTGGAAAGGGAATGG - Intronic
1111915463 13:94355928-94355950 CTGTTGTGGGGGCAGGGGGAGGG - Intronic
1112429917 13:99342371-99342393 TTGGGGCAGGGGCAAGGGGTGGG + Intronic
1115121677 14:29944207-29944229 CTGCTCCAGGGGCAGGGTGATGG - Intronic
1115469830 14:33756992-33757014 CTGATGGTGGGGCATGGGGAAGG + Intronic
1115673618 14:35644762-35644784 CTGTTGGTGGGGGAAGGTGAGGG + Intronic
1116247247 14:42431717-42431739 CTGTTGGAGGGGCAGCGGTAGGG - Intergenic
1116271531 14:42775064-42775086 CTGTTGCGGGAGCAAGGGGAGGG + Intergenic
1116547151 14:46182785-46182807 GGGGGGCAGGGGCAAGGGGAAGG - Intergenic
1116707978 14:48327726-48327748 CTATTGTGGGGGTAAGGGGAGGG - Intergenic
1116985376 14:51213769-51213791 CTGTTGTAGGGTGGAGGGGAGGG - Intergenic
1117218632 14:53578703-53578725 ATGTGGCAGGGGGATGGGGAAGG + Intergenic
1117477732 14:56114235-56114257 GGGTGCCAGGGGCAAGGGGAAGG + Intergenic
1120275834 14:82371123-82371145 CTCTTCCTGGGGAAAGGGGAGGG + Intergenic
1120676721 14:87429139-87429161 CTGTTGTGGGGGGAAGGGGGAGG + Intergenic
1121707374 14:96008287-96008309 CTGTTGCGGAGGGCAGGGGAAGG + Intergenic
1122023518 14:98858635-98858657 GAGGTGCTGGGGCAAGGGGAGGG - Intergenic
1122055637 14:99096369-99096391 GTGGTTCAGGGGCAAGGAGAGGG + Intergenic
1123110380 14:105864386-105864408 CTGCTGCTGGGGCAAAGGGTGGG - Intergenic
1123918434 15:25054182-25054204 CATTTGAAGGGGCAAGGGGCAGG - Intergenic
1124387653 15:29223775-29223797 CTGTTGCAGGGACTGGGGAAAGG - Intronic
1124518840 15:30393127-30393149 CAGTTGCAGGAGAAAGGGGCGGG + Intronic
1124552274 15:30692889-30692911 CTGTTTCTGGGGCTTGGGGAAGG + Intronic
1124678965 15:31712777-31712799 CTGTTTCTGGGGCTTGGGGAAGG - Intronic
1125299937 15:38244678-38244700 ATGTTGCAGTGGGAAGAGGAGGG + Intergenic
1126371225 15:47949378-47949400 CAGGTCCAGGGGCAAGGGGAAGG - Intergenic
1127192568 15:56546738-56546760 CTCTTGCAGGGTGGAGGGGAAGG + Intergenic
1127725505 15:61745388-61745410 CTGTGGACGGGGCAAGGGGATGG - Intergenic
1128029463 15:64466941-64466963 CTGCTGCTAGAGCAAGGGGAGGG - Intronic
1128723542 15:69971057-69971079 CTGGGGCAGGGACAAGGGAACGG - Intergenic
1128780013 15:70353101-70353123 TGGTTGCAGGGGCTCGGGGAGGG - Intergenic
1129194270 15:73954845-73954867 CAGTTGAAGGGGAGAGGGGATGG - Intergenic
1129460622 15:75698458-75698480 CCCTTGGAGGTGCAAGGGGAGGG - Intronic
1129724243 15:77893582-77893604 CCCTTGAAGGTGCAAGGGGAGGG + Intergenic
1130367872 15:83256895-83256917 CTGGTGCAGGGCTGAGGGGAGGG + Exonic
1131112996 15:89776913-89776935 CAGGGGCAGGGGCAAGGGCAGGG + Exonic
1131679042 15:94702383-94702405 CTGCTGCAGGGGCAAAGGGAGGG - Intergenic
1131723866 15:95201738-95201760 CTTTTGCAGGTGCAAGGTGCAGG - Intergenic
1131781612 15:95865813-95865835 CTGCTGCAGGAGAAAGGGCATGG - Intergenic
1132209641 15:100010469-100010491 GTGTTGCAGGTGCACTGGGAAGG - Intronic
1132691050 16:1182113-1182135 CTGTGGCAGGGGCAGGAGCAGGG + Intronic
1132972959 16:2697813-2697835 CAGGGGCAGGGGCAAGGGCAGGG + Intronic
1133980946 16:10632980-10633002 CTGTTGAACGGGAAACGGGAAGG + Intronic
1134073725 16:11276291-11276313 CAGTTGCATGGGCAAGAGCAAGG - Exonic
1135047118 16:19165120-19165142 ATGGTGCAGGGGCTAGGGAAAGG + Intronic
1135825016 16:25719219-25719241 AAGTTGCTGGGGCAAAGGGAGGG + Intronic
1135841478 16:25880648-25880670 CTGTTGCAGTGGGGAGGGGGAGG - Intronic
1136053612 16:27671656-27671678 CAGTTGCAGGTGAAAGAGGAAGG - Intronic
1136452418 16:30360905-30360927 ATAGTGCAGGAGCAAGGGGAGGG - Intronic
1137396164 16:48117416-48117438 GTGTTGCTGGGGCAAGGCCAGGG + Intronic
1138480916 16:57302939-57302961 GTGTGGCAGGGGTAAGGTGATGG + Intergenic
1138516500 16:57538157-57538179 CTTTTGCAGGGGCTAGGGTGGGG + Intergenic
1139043653 16:63030733-63030755 CTGATGCAGAGGGATGGGGATGG + Intergenic
1139336700 16:66236963-66236985 CTGTAGCTGGGACAAGGAGATGG - Intergenic
1139482426 16:67237822-67237844 CTGTTGCTGGGGAAGGGGAAGGG + Intronic
1139521787 16:67486931-67486953 CTGGGGCAGGGGCAATGGGCTGG - Intergenic
1140057805 16:71540808-71540830 CTGTTGCTGGGGGTTGGGGATGG - Intronic
1140249330 16:73281444-73281466 TGGTTGCAGGGGCTGGGGGAAGG + Intergenic
1140287068 16:73613848-73613870 CTGCTGCTGCGGCAGGGGGAGGG + Intergenic
1140332249 16:74069553-74069575 ATGGGGCAGGGGCAAGGAGAGGG + Intergenic
1140403882 16:74694723-74694745 CTGTTGCACGGGCTAGAGGACGG - Intronic
1141031060 16:80588988-80589010 CTGTGATAGGGGCAAGAGGAAGG + Intergenic
1141680904 16:85543268-85543290 CTGTTCCAGGGGCTAGGAGATGG + Intergenic
1141693305 16:85608330-85608352 CCGGTGCAGGGGCAAGGGGCGGG - Intergenic
1142110734 16:88329703-88329725 CTGTTCCAGGGGAAAGGGGACGG + Intergenic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1142204740 16:88777568-88777590 CTGAGGCAGGGGCAGTGGGATGG + Intronic
1142275351 16:89115699-89115721 CCATTGCAGGGGGAAGGGGATGG - Intronic
1142476165 17:191609-191631 CTGTCGCAGGGGCGGGGGAACGG - Intergenic
1142545926 17:702766-702788 CTGCTGGAGGGGAAAGGGAAAGG + Intronic
1143108787 17:4542275-4542297 GTGTGGCAGGGGCCAGGGCACGG + Intronic
1143755089 17:9061191-9061213 CTGGTGGAGGAGGAAGGGGAGGG + Intronic
1143902207 17:10182831-10182853 CTGTTGCTGGGGCAAAGGAAAGG - Intronic
1144270796 17:13613754-13613776 CTGTAGGAGGGCCAAGGGAAGGG + Intergenic
1144462249 17:15467596-15467618 TTGGGGCAGGGGCAAGAGGATGG - Exonic
1144630903 17:16871956-16871978 CTGGTGCGGGGGCAAGAGGGAGG + Intergenic
1144795511 17:17888698-17888720 CTATTGCTGGGGCATGGGGAGGG + Intronic
1146518334 17:33507036-33507058 CTGGGGCAGGGTCAAGGGGCCGG + Intronic
1146682165 17:34816212-34816234 CTGTTGCAGTGGGGTGGGGAGGG - Intergenic
1147161116 17:38569859-38569881 CTGTGGCCTGGGGAAGGGGAGGG + Intronic
1147614471 17:41820084-41820106 CTGGGGCAGGGGGCAGGGGAAGG - Intronic
1147948451 17:44093483-44093505 CTGCTGCAGGGGCATGGGAACGG + Exonic
1147976020 17:44248488-44248510 ATGTTCAAGGAGCAAGGGGAGGG + Exonic
1147992487 17:44343681-44343703 ATGAGGCAGGGGCAGGGGGATGG - Intergenic
1148464624 17:47857562-47857584 CTGATCCAGAGGCCAGGGGAAGG - Intergenic
1148644496 17:49211347-49211369 CTCATGCAGAGGCAGGGGGATGG + Intronic
1148722357 17:49763460-49763482 CTATTGCACGGGGAGGGGGAGGG - Intronic
1148846388 17:50532513-50532535 CTGTTGAAGAGGCAGGGGAAGGG + Intergenic
1148852117 17:50560497-50560519 CGGACCCAGGGGCAAGGGGAGGG + Intergenic
1149098673 17:52876184-52876206 TTGTTGCAGGGGCAGGAGGTGGG + Intronic
1149498726 17:57135561-57135583 CGGTTCCAGGGGAAAGTGGAGGG - Intergenic
1150216770 17:63475735-63475757 GTGTTGCAGGGGAGAGGGGGCGG - Intergenic
1150263663 17:63817752-63817774 CTGCTGCTGGGGCAAGTGGGTGG + Exonic
1150932158 17:69596452-69596474 CTGTTGCAAGTCCAACGGGAGGG + Intergenic
1151770729 17:76158920-76158942 CTGTGGCAGAGTAAAGGGGAGGG - Intronic
1151986774 17:77548723-77548745 CTGGTGCTAGGGAAAGGGGAGGG + Intergenic
1152032774 17:77854296-77854318 CTGCAGCAGAGGCCAGGGGAGGG - Intergenic
1152135652 17:78501707-78501729 CTGTCCCAGGGGCCAGGGGAAGG - Intronic
1152312140 17:79557900-79557922 TGTTTGCTGGGGCAAGGGGACGG + Intergenic
1152450167 17:80373490-80373512 CTGCTGTAGGGCCAAGGTGAGGG + Intronic
1153752134 18:8243457-8243479 CTGTAGGAGGATCAAGGGGAAGG - Intronic
1154496387 18:14964109-14964131 CCCATGCAGGGGCAAGGGTACGG + Intergenic
1155081487 18:22414646-22414668 CTCTTGCTGTGGCAAGGGGAAGG - Exonic
1155293634 18:24365654-24365676 CTGGGGCATGGGAAAGGGGAAGG + Intronic
1155499592 18:26473403-26473425 CTGTAGCAGGGATAGGGGGAGGG + Intronic
1155854974 18:30821743-30821765 CTGCTGTAGGGCCAAGGAGAGGG + Intergenic
1156139710 18:34091735-34091757 CTGATGCAGGAGAAAGAGGACGG + Intronic
1157142460 18:45123399-45123421 GTGTGGCGGGGGCAGGGGGATGG + Intergenic
1157441780 18:47717164-47717186 CAGCTGCAGGGGGAAGGGGCAGG + Intergenic
1158119047 18:54028066-54028088 CTGTTGTAGAGGCAATGGGAGGG - Intergenic
1158468369 18:57712280-57712302 CTGGTGCTGGGGCTGGGGGAGGG - Intronic
1158864873 18:61628634-61628656 TTGTGGTAGGAGCAAGGGGACGG + Intergenic
1160230687 18:77046593-77046615 CAGCTGCAGGGGCAAGGCCAGGG + Intronic
1160498289 18:79388019-79388041 CTGGTGGAGTGGCAGGGGGAGGG - Intergenic
1160512337 18:79459555-79459577 CTTTGGCACTGGCAAGGGGAGGG - Intronic
1160598873 18:79997341-79997363 CTGTTGCAGGGGCTTGTGCAGGG - Intronic
1160602829 18:80027276-80027298 CTGTTGCAGGGGCTTGTGCAGGG - Intronic
1161713230 19:5861722-5861744 CAGTTGCAGGAGCCAGTGGAAGG - Intergenic
1161741298 19:6022633-6022655 CTCTTCCAGAGGGAAGGGGACGG - Intronic
1161990092 19:7679844-7679866 CTGTTACTGGGGCAAGGGGAGGG + Intronic
1162461803 19:10818044-10818066 CTTTAGAAGGGGCTAGGGGAGGG - Intronic
1162499338 19:11042581-11042603 CTGTTGGAGGGGAAAGTGAAGGG + Intronic
1162563937 19:11434926-11434948 CTCTTCCAGGGTCAAGGGCAGGG - Exonic
1163441199 19:17323554-17323576 CTGGGGCTGGGGCTAGGGGAGGG + Exonic
1164177928 19:22793548-22793570 CTGTCAGAGGGGCAAGGGGAGGG - Intergenic
1164585628 19:29473073-29473095 GGGTTGCAGGGGCCGGGGGAGGG - Intergenic
1164922483 19:32099512-32099534 CTGTTGCCGGGGCGAGGGGAGGG - Intergenic
1164927150 19:32139527-32139549 TTGTTGCTCAGGCAAGGGGAGGG - Intergenic
1165108875 19:33489731-33489753 CAGGGGCAGGGGCAAGGGCAGGG - Intronic
1165138752 19:33686919-33686941 CTATTGCACGGTCATGGGGACGG - Intronic
1165428375 19:35757791-35757813 CTGTTGCAGGGGCAGTGGGGCGG - Intronic
1166202706 19:41248855-41248877 CTGTCTCAGGGGCATAGGGAAGG - Intronic
1166802243 19:45465439-45465461 CTGTGGCAGAGCCAAGGCGATGG - Intronic
1166959258 19:46488083-46488105 AGGTTGCGGGGGCAAAGGGAAGG + Intronic
1167320120 19:48792388-48792410 CTGTTGCAGGGTGGTGGGGAGGG - Intergenic
925069522 2:955961-955983 CAGATGCAGGGGCAGGGGCAGGG - Intronic
926108012 2:10164660-10164682 CAGATGCAGGGACTAGGGGAGGG + Intronic
926212581 2:10882058-10882080 CTGTTGTGGGGGCAGGAGGAGGG - Intergenic
926703506 2:15819897-15819919 CTGTGGGAGGGGCAAGGCGGAGG + Intergenic
926914561 2:17879336-17879358 CAGCTGCAGGGCAAAGGGGAGGG - Intronic
927064858 2:19461067-19461089 CAGTTGCAGGGGGAGGGGGATGG - Intergenic
927173929 2:20392259-20392281 CTGCTGCAGGGTCAGGGAGAAGG - Intergenic
927993548 2:27465582-27465604 CTGGTGATGGGGCAAGGGGAGGG + Intronic
928720478 2:34115134-34115156 TTATTGCAGAGGGAAGGGGAGGG + Intergenic
929552082 2:42900773-42900795 CTGTTGCTGGGGCCTGTGGATGG + Intergenic
929625870 2:43406105-43406127 TTCTTGCAGGGGCAAGTGGAGGG - Intronic
930149213 2:48041255-48041277 CTGTTGGAGGGGTGAGTGGAGGG - Intergenic
930320480 2:49848408-49848430 CTGTTGGAGGGGTAGGGGGAGGG - Intergenic
931243947 2:60477451-60477473 TGGGTGGAGGGGCAAGGGGAGGG + Intronic
931460881 2:62449037-62449059 CTGGTGCTGGGACAAGGGTATGG - Intergenic
932036853 2:68253920-68253942 CTCCTGAAGGGGGAAGGGGAGGG - Intronic
932305966 2:70704534-70704556 CTGACCCAGGGGCAAGGGGTGGG - Intronic
932544064 2:72688528-72688550 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
932612208 2:73208263-73208285 CTGTTACCTGGCCAAGGGGAAGG + Intronic
933605912 2:84383409-84383431 CTGTTGTAGGAGCCAGGGGATGG - Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934748273 2:96774148-96774170 CTGTGGGAGGGGGCAGGGGAAGG + Intronic
935236120 2:101139569-101139591 CTGAGGCATGGGCAAGGGGCAGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936767318 2:115868594-115868616 ATATTTCAGGGGCAGGGGGAGGG + Intergenic
936957388 2:118036462-118036484 CTGTTGGAGGGGTGAGGGGAGGG - Intergenic
937033609 2:118762363-118762385 CTGCTCCAGAGGCCAGGGGATGG + Intergenic
937047271 2:118858534-118858556 GTGTTGCAGGGGGAAGGGCAGGG - Intergenic
937060395 2:118976522-118976544 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
937762900 2:125627386-125627408 CTGTTGCAGGGGAGGGGGCAAGG + Intergenic
937846187 2:126581739-126581761 CTGTTGGCGGGGTCAGGGGAGGG + Intergenic
938483168 2:131679135-131679157 CTGTTGCGGGGCCCAGGGAAGGG - Intergenic
938598296 2:132811611-132811633 CTGTTGAGGGGGCAGGGGGCAGG - Intronic
938606061 2:132894063-132894085 CAGTTGCTGAGGCAAAGGGACGG + Intronic
938619121 2:133031235-133031257 CTGCTGCTGGGGGTAGGGGAGGG - Intronic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
942729207 2:179045159-179045181 CTGTTGTGGGGTCGAGGGGAGGG - Intronic
944961916 2:204884605-204884627 CTGTTGCTGGGGCCAGGGGGAGG - Intronic
945520585 2:210822420-210822442 CTGTCAGAGGGGCATGGGGAGGG + Intergenic
945587923 2:211690308-211690330 CTTTAGCAGAGGTAAGGGGAAGG - Intronic
946114036 2:217446069-217446091 CTGGCCTAGGGGCAAGGGGATGG + Intronic
946144996 2:217724007-217724029 CTGTTGGAGGTGCAAGCTGACGG + Intronic
947537081 2:230946825-230946847 CTGGGGCAGGGGCCAGGGCAAGG + Intronic
947684993 2:232075751-232075773 CTGAAGCAAGGGGAAGGGGAAGG - Intronic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
947859559 2:233348972-233348994 CTGTGGCAGAGGACAGGGGAAGG - Intergenic
948110876 2:235454838-235454860 CTCTTACAGGGGAAAGGGGGAGG + Intergenic
948271741 2:236678910-236678932 CTGGAGCAGGGGTAAGGGGCAGG + Intergenic
948599753 2:239101515-239101537 GGGTTGCAGGGGCAAGGAGAGGG - Intronic
948853561 2:240719832-240719854 CTGTTGCCCGGGCAGGGGAAGGG + Exonic
948904045 2:240969378-240969400 CTTCTGCAGGGGAGAGGGGAGGG + Intronic
1168807837 20:683121-683143 CCCTGGCAGGGGGAAGGGGAGGG - Intergenic
1169721285 20:8679400-8679422 TTGTTGCAAGGCCAATGGGATGG + Intronic
1169867605 20:10218096-10218118 CTGTTGCAGGAGTCGGGGGAAGG - Intergenic
1169891533 20:10458512-10458534 CTGTTGTGGGGGAAGGGGGAGGG - Intronic
1169952483 20:11060763-11060785 CTGTTGATGGGGTCAGGGGAAGG + Intergenic
1170652646 20:18256926-18256948 CTGTTCCAGGGTTATGGGGATGG - Intergenic
1170668248 20:18405826-18405848 CTGCTGCTGGGGGATGGGGAAGG - Intronic
1170739178 20:19038976-19038998 CTGTTGTGGGGGTGAGGGGATGG + Intergenic
1171782320 20:29430605-29430627 CTGCGGCAAGAGCAAGGGGACGG - Intergenic
1172178654 20:32987498-32987520 CAGATGCAGGGGCAAAGGCAGGG - Intronic
1172425137 20:34850997-34851019 CGGTTGCAGGGGAAATGGCAGGG - Intronic
1172656774 20:36542514-36542536 CTGGTGGAGGGGCGAGGGGCAGG - Intronic
1172845847 20:37929672-37929694 CTGTTGCAGGTGAGAGAGGATGG + Intronic
1173567155 20:44049641-44049663 GCGTTGAGGGGGCAAGGGGAGGG - Intronic
1173758742 20:45541230-45541252 CTGTTGAGGGGGCAGGGGGAGGG + Exonic
1173981765 20:47229959-47229981 CAGGTGCAGGAGCAAGGAGAAGG + Intronic
1174719019 20:52791011-52791033 CAACTGAAGGGGCAAGGGGAAGG + Intergenic
1174963387 20:55183730-55183752 CAGGTGCATGGGGAAGGGGATGG + Intergenic
1175370339 20:58483942-58483964 CTGAGGCAGAGGCCAGGGGAGGG + Intronic
1175538888 20:59735975-59735997 CTGTTGATGGGGGAAAGGGATGG + Intronic
1175618710 20:60424875-60424897 TGGTGGCAGTGGCAAGGGGAGGG + Intergenic
1175645451 20:60667069-60667091 CAGTCGCAGGGGCTGGGGGAGGG - Intergenic
1175685630 20:61026194-61026216 CTGTTGTGGGGGAACGGGGAGGG - Intergenic
1175723404 20:61300935-61300957 CAGCTGCAGGGGCCGGGGGAGGG - Intronic
1175936730 20:62517645-62517667 CTGTTGTGGGGGCATGGGGGAGG - Intergenic
1177087236 21:16721112-16721134 GGGTTGCAGGGGCTAGGAGAGGG + Intergenic
1177674542 21:24279670-24279692 ATTTTGCGGGGGCAGGGGGAGGG - Intergenic
1178599966 21:33986615-33986637 CTGTTGCAGGGGTTCGGGGAAGG + Intergenic
1178802770 21:35811453-35811475 GTGATGCAGGGGCAGGGGGCAGG + Intronic
1179043010 21:37821538-37821560 CTGTTGGGGGGGCAGGGGAAAGG - Intronic
1179266012 21:39804486-39804508 CTGTGGCAGGCTCAAGGGGGTGG + Intergenic
1179311496 21:40199773-40199795 CGGTGGGTGGGGCAAGGGGAGGG + Intronic
1179578521 21:42322730-42322752 CAGTTGTTGGGGCAAGGGCAGGG + Intergenic
1179680098 21:43013705-43013727 GGGTTCCAGGGGCTAGGGGAGGG - Intronic
1179715082 21:43282279-43282301 CTGTGGCTGGGGCAAGGGCCAGG - Intergenic
1179787048 21:43735883-43735905 GTGTGGCAGGGGCGAGGGAAGGG - Intronic
1179800518 21:43809645-43809667 CTGCGGCAGGGGTGAGGGGAGGG + Intergenic
1180207449 21:46269939-46269961 GGGTTGCAGAGGCAATGGGAAGG - Intronic
1180574777 22:16762873-16762895 CTGATGCATGGGCAAGGGCCTGG - Intergenic
1180626792 22:17199114-17199136 CTGGTGGAGGGGGAGGGGGAGGG - Intronic
1180987133 22:19911701-19911723 CTGAACCAGGGTCAAGGGGAGGG - Intronic
1181031445 22:20150351-20150373 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1181098509 22:20522745-20522767 CTGCTGCAGGAGCAAGTGGGTGG + Intronic
1181815481 22:25433599-25433621 CTGTCGGAAGGGGAAGGGGAAGG + Intergenic
1182019254 22:27067132-27067154 CTGTAGCAGAGGCCAGGGAAAGG - Intergenic
1182100281 22:27652872-27652894 CTGTGGCAGGGCCAAGGGCCAGG - Intergenic
1182447376 22:30397498-30397520 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1183387772 22:37525026-37525048 CTCCTGCAGGGGCCAGAGGAAGG + Intergenic
1183397094 22:37577914-37577936 CTGCTGAAGGCGCAAGGGGAGGG - Intronic
1183891609 22:40934411-40934433 ATCTTGGAGGGGCAGGGGGAGGG + Intergenic
1184318173 22:43715248-43715270 GTGTTGCAGGGTTAAGGGCAGGG + Intronic
1184607715 22:45583748-45583770 CCCTTGCAGGGCCAATGGGAAGG + Intronic
1185147913 22:49149426-49149448 CTTTTGCAGGGCCAGGAGGAAGG + Intergenic
949157357 3:845551-845573 CTGCTGCAGGGGCAGTGGGAGGG - Intergenic
950376452 3:12576380-12576402 TCGGTGCAGGGGCAAGGGGAGGG - Intronic
950442935 3:13020249-13020271 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
950611970 3:14132665-14132687 CTGTTGGTGGGGCCATGGGAAGG + Intronic
950707158 3:14790021-14790043 CTTTTGCAGGTGCAAGAGGCAGG + Intergenic
950866606 3:16194824-16194846 CTGTTGTGGGGGCATGGGGAGGG + Intronic
951492589 3:23288922-23288944 CTGCTGCTGGGGCATGGGGGAGG + Intronic
952088409 3:29854185-29854207 CTGCTGCAGGGACGCGGGGAGGG - Intronic
952342611 3:32458499-32458521 CGGTTGCCAGGGCCAGGGGAAGG + Intronic
952651273 3:35729475-35729497 CTGTTGCAGCTTCAAGTGGAAGG - Exonic
952889625 3:38031325-38031347 CTGTGCCAGGGGCCAGAGGAGGG - Intergenic
952970523 3:38648131-38648153 CTGTTGCAGGAGCATGGAGAGGG - Intronic
954064058 3:48091690-48091712 CTGAAGCAGGAGCAAGGGGAAGG - Intergenic
954374271 3:50185872-50185894 TTGTTGCTGGGGCAAAGGGTAGG - Exonic
954509159 3:51106582-51106604 CTGGTGCAGGGGCAAGGCACTGG - Intronic
956231618 3:67022812-67022834 CTGTCAGTGGGGCAAGGGGAGGG + Intergenic
957228476 3:77479428-77479450 CTGTTCTTGGGGCAAGTGGAGGG + Intronic
957265955 3:77966111-77966133 CTGGAGTAGGGGGAAGGGGAAGG + Intergenic
957862834 3:85979198-85979220 CTGTTGCAGTGGTAAGGGAGGGG - Exonic
958963783 3:100536153-100536175 TTGGTGCAGGGGCAGGGTGAGGG - Intronic
960739595 3:120818545-120818567 CTGTCGCGGGGGCAGGGGCAAGG - Intergenic
960779877 3:121308099-121308121 CTGTTGTTGGAGCAGGGGGAGGG + Intronic
960868968 3:122230526-122230548 CTGTTGCAGGGGGTGGGGGATGG - Intronic
960988727 3:123296914-123296936 CTGCTGCCTGGGCAAGGGGCGGG - Intronic
961372584 3:126440630-126440652 CAGGAGCAGGGGCAGGGGGAGGG - Intronic
961818471 3:129563321-129563343 CTGTTGGAGGGGTTGGGGGACGG - Intronic
961906668 3:130269883-130269905 CTGGGGCAGGGGCAGGGGCAGGG - Intergenic
961937495 3:130600711-130600733 GGGTTGGTGGGGCAAGGGGAGGG + Intronic
962471957 3:135716950-135716972 CTGGTACAGTGGGAAGGGGAAGG + Intergenic
962573675 3:136736272-136736294 TTGTTCTAGGGGCAAGGAGAGGG + Intronic
962622048 3:137189949-137189971 CTTCTGCAGAGGTAAGGGGATGG + Intergenic
963589174 3:147234989-147235011 CTGTCAGTGGGGCAAGGGGAGGG - Intergenic
963677735 3:148334116-148334138 GTGTTGGGGGGGCGAGGGGAGGG - Intergenic
964368609 3:155975414-155975436 CTGTTGGAGGGATAAGGGGAGGG - Intergenic
965097144 3:164245304-164245326 CGGAGGCTGGGGCAAGGGGATGG - Intergenic
965867148 3:173217656-173217678 CTGCTGCAGGGTGATGGGGAGGG + Intergenic
965890291 3:173505044-173505066 GTGTGGCGGGGGCAAGGGGTGGG - Intronic
966878154 3:184335289-184335311 CTGTTGCCTGGGCAGGGGGAAGG + Exonic
967078119 3:186023560-186023582 ATGATGGAGGGGGAAGGGGAGGG + Intergenic
967443789 3:189540735-189540757 CAGGTGCAGGAGCAAGGTGAGGG - Intergenic
967621410 3:191639263-191639285 CTGTTGCGGGGACAGGGGAAGGG - Intergenic
968844032 4:3029816-3029838 CAGTGGCAGGAGCATGGGGAAGG - Intronic
968862106 4:3180789-3180811 CCGGTGCAGGGGGATGGGGAGGG + Intronic
969051912 4:4379261-4379283 CTGTTGTGAGGGCGAGGGGAGGG - Intronic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
970638422 4:18036250-18036272 ATGGGGCAGGGGCAAGGAGAAGG + Intergenic
971253065 4:24989287-24989309 GTGTTCCAGAGGGAAGGGGAGGG + Intergenic
971772202 4:30911159-30911181 AGGTTGTGGGGGCAAGGGGAGGG + Intronic
972238942 4:37167831-37167853 CTGTTGGAGGGGCAGGGGGATGG + Intergenic
973568438 4:52212387-52212409 CTGTTGGAGGGGTAAAGGGAGGG + Intergenic
973852549 4:54975502-54975524 GTGTTGCAGGGAGATGGGGATGG - Intergenic
974197126 4:58589902-58589924 TATTTTCAGGGGCAAGGGGAGGG - Intergenic
976040961 4:80884994-80885016 CTGTTGCTGGGGTATGGGGGAGG - Intronic
976155965 4:82145042-82145064 GTGGTGGAGGGGCATGGGGAAGG - Intergenic
976196202 4:82534304-82534326 CTTTTGCAGGGGTGAGGTGAGGG - Intronic
976401832 4:84615578-84615600 CTGTGGCAGGGGGAGGGGGTGGG - Intronic
976493201 4:85695358-85695380 CTGTTACATGGGTATGGGGAAGG + Intronic
976771624 4:88659257-88659279 CTCTTGGAGGAGCAAGGGAATGG + Intronic
977917904 4:102614117-102614139 GTGTTGCATGAGTAAGGGGAGGG - Intronic
978709342 4:111759116-111759138 GTGGGGCAGGGGCAAGGGGGAGG + Intergenic
979530999 4:121769127-121769149 CTGTGGCATGGGCAAGATGAGGG + Intergenic
979776193 4:124590969-124590991 CTGTTGGAGGGACAAGGGTAAGG - Intergenic
979921200 4:126498712-126498734 CTGTTGGTGGGTCAGGGGGAAGG + Intergenic
980519521 4:133912142-133912164 CTGTTGTGGGGGACAGGGGAAGG + Intergenic
981665817 4:147224852-147224874 GGGTGGTAGGGGCAAGGGGAGGG + Intergenic
982134401 4:152259497-152259519 CTGTGGCAGGGGGAGGGGCATGG - Intergenic
982141361 4:152322814-152322836 TTTTTGCAGGGGGAAGGGCAGGG + Exonic
983589100 4:169388229-169388251 CTGTTGCGGGGGGGAGGGCAAGG - Intergenic
985239544 4:187915598-187915620 CTGTTGGGGGCACAAGGGGAGGG + Intergenic
985266881 4:188159189-188159211 CTGTCGGTGGGGCAGGGGGAGGG - Intergenic
985573960 5:665194-665216 CTCTGGCAAGGGCAAGGGCAAGG - Exonic
985774181 5:1832036-1832058 CTGTTGCAGGGGCACCAAGAGGG + Intergenic
986648366 5:9940327-9940349 ATGATGCAGGAGGAAGGGGAAGG + Intergenic
986695155 5:10348532-10348554 CTTTTCCATGGGCAAGGGCACGG - Intergenic
987077540 5:14398096-14398118 CTGTTCCTGGGGCTGGGGGATGG + Intronic
987205166 5:15618008-15618030 GTGTTGCAGGGGTTGGGGGAGGG + Intronic
988006492 5:25418476-25418498 CTGGAGCAGGAGGAAGGGGAGGG + Intergenic
988456071 5:31388368-31388390 CTGATGCAAGGGCAAGGGATGGG + Intergenic
988647490 5:33110267-33110289 CTGTTGCAGGGGGTCGGGGGAGG - Intergenic
989194764 5:38705900-38705922 CGGGTTCGGGGGCAAGGGGAGGG + Intergenic
989270952 5:39532294-39532316 CTGTTGAAGGGGGAAGCTGAAGG - Intergenic
990776167 5:59308646-59308668 CTGGTGCAGGGGGTAGGGGTTGG + Intronic
992326317 5:75663541-75663563 TTCTTGCAGGGGCAATGGGGGGG + Intronic
994331258 5:98509114-98509136 CTGTTGAAGTGGTAAGGGGCAGG + Intergenic
994891686 5:105643939-105643961 CTGCTACAGGGGGAAAGGGAGGG - Intergenic
995438610 5:112164965-112164987 CTGATGAAGGGTCAAGGGTAGGG - Exonic
995465924 5:112449295-112449317 CTGATGCAGTGGCAAAGGGTTGG + Intergenic
995842125 5:116452531-116452553 ATGTTGCAGGGTCTAGGGGCAGG - Intronic
996210018 5:120797740-120797762 CTGCTGCTGGGGGATGGGGATGG - Intergenic
996542866 5:124648157-124648179 CTGGGGCAGGGGCAATGGGCCGG + Exonic
998294475 5:140953932-140953954 CTGTTGGGGGAGCAATGGGAGGG - Intronic
998480372 5:142458289-142458311 CTGTGACAGTGGAAAGGGGAGGG - Intergenic
998668357 5:144324920-144324942 CTGTGGCAGGGGTGAAGGGAGGG + Intronic
999426699 5:151493783-151493805 CTGTTGCAGCCTCAAGAGGAAGG + Intergenic
1000671263 5:164066122-164066144 CTGTTGCAGAGGGAAGTCGAAGG - Intergenic
1001084697 5:168692115-168692137 CTGTTGCAGGGGAAGGGGGCAGG - Intronic
1001317292 5:170652903-170652925 GTTTTGCAGGGGCAAGGTGGGGG - Intronic
1001343665 5:170870365-170870387 CTGTTGTGGGGGTGAGGGGAGGG - Intronic
1003756905 6:9131749-9131771 CTCTTGCTGGGGCAACAGGAAGG - Intergenic
1004942770 6:20578350-20578372 CTGCTGCAGAGGGGAGGGGAAGG - Intronic
1006173631 6:32109269-32109291 CTGTTGCAGGGGACAAGTGAGGG - Intronic
1006174956 6:32116135-32116157 TTGGTGCAGGGGCAAGGAGAGGG + Intronic
1006463113 6:34175385-34175407 CTGCTGCAGGGGAATGGGAAGGG + Intergenic
1006589134 6:35141349-35141371 CGGTCGCCGGGGCAACGGGACGG + Exonic
1007001586 6:38318994-38319016 CTCTGGCTGGGGCAAGGGGTGGG - Intronic
1007068931 6:39020666-39020688 CTATTGGTGGGGGAAGGGGAAGG - Intronic
1007094043 6:39202462-39202484 CTGGGGAAGGGGCAAGGTGAGGG + Intronic
1007431151 6:41778058-41778080 CCGTGGGAGGGGCATGGGGAAGG + Exonic
1009777632 6:68225589-68225611 TTTTTGCAGCGGCAAGTGGATGG + Intergenic
1010280554 6:74018546-74018568 CTGCTGCTGGGGGATGGGGAAGG - Intergenic
1010564746 6:77396683-77396705 AGGTAGCAGGGTCAAGGGGAGGG - Intergenic
1010624118 6:78114793-78114815 CTGTTGGGGGGACAAGGGGAGGG + Intergenic
1011105282 6:83773004-83773026 TGGGGGCAGGGGCAAGGGGAGGG - Intergenic
1011446341 6:87445355-87445377 TTGCTGGAGGGGCAAGGAGAAGG - Intronic
1011628587 6:89302949-89302971 CTGGTACATGGGCAAGGGCATGG + Intronic
1012449946 6:99344360-99344382 CTCAGGCAGGGCCAAGGGGAAGG - Intronic
1012686383 6:102255856-102255878 CTGTTGTGGGGACAAGGGGAGGG - Intergenic
1013333655 6:109133231-109133253 ATGCGGCAGGGGTAAGGGGATGG + Intronic
1013513185 6:110861810-110861832 CTGTTGCAAGAGCAAGTGGCTGG - Intronic
1013554008 6:111237747-111237769 CTGCTCCAGGGCCAAGGAGAAGG + Intergenic
1014422866 6:121266911-121266933 GTGGGGAAGGGGCAAGGGGAGGG + Intronic
1015702918 6:136055799-136055821 ATGTGGCATGGGCAAGGGGGCGG + Intronic
1016183074 6:141170944-141170966 CTGTGGCAGTGTCTAGGGGAGGG + Intergenic
1016360382 6:143261088-143261110 ATGTTGCAGAGGAATGGGGAAGG + Intronic
1017363893 6:153609692-153609714 TTGGTGGCGGGGCAAGGGGAGGG + Intergenic
1018460504 6:163994354-163994376 CTGTCAGAGGGGCAAGGGAAGGG + Intergenic
1018813023 6:167311386-167311408 CCCTTGCAGAGGCCAGGGGATGG - Intronic
1019419856 7:945894-945916 CTGGGGCACGGGCAGGGGGAAGG + Intronic
1019549706 7:1595870-1595892 CTGTGGCACGGGCATGGGGTGGG + Intergenic
1019574159 7:1728239-1728261 CTACTGCAGTGGCAGGGGGATGG - Intronic
1020240140 7:6388057-6388079 GTGTTGAAGGGGGAATGGGAGGG + Intronic
1020331638 7:7023325-7023347 CTGTTGGTGGTGCAAGGGCAGGG - Intergenic
1020551086 7:9605698-9605720 GGGTTCCGGGGGCAAGGGGAGGG - Intergenic
1021731679 7:23601280-23601302 CTGAGGCAGGGGCAAGGGTGGGG + Intronic
1022499273 7:30872378-30872400 CTTTTTCTGGGGCAAGAGGAGGG - Intronic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1024369242 7:48560383-48560405 CTGCTGCAGGGGTATGGGGGAGG + Intronic
1024803493 7:53108477-53108499 CACCTGCAGGGGCAAGGGGCGGG + Intergenic
1024914122 7:54479859-54479881 CTGGAACAGAGGCAAGGGGAAGG + Intergenic
1025605111 7:63034264-63034286 CTGTTGCAGGGGTAAAAGAAAGG - Intergenic
1026633997 7:72065373-72065395 CTGGGGCAGGGGCAGGGGGGCGG - Intronic
1026945909 7:74316031-74316053 CTGTTGTGGGGGCGGGGGGAGGG - Intronic
1027222924 7:76225478-76225500 CTTTTGCCGGGGAAAGGGGCGGG - Intronic
1027224392 7:76234882-76234904 CTGGTGCAGAGGGAAGCGGACGG - Intronic
1027734611 7:81916905-81916927 TTGGTGTAGGGGCGAGGGGAGGG - Intergenic
1028508453 7:91595634-91595656 CTGTTGTGGGGGGATGGGGAGGG + Intergenic
1029010069 7:97250445-97250467 CTGTCAGAGGGGCAGGGGGAGGG - Intergenic
1029438396 7:100574770-100574792 CTGTTGGGGGGGGAAGGGGAGGG + Exonic
1030018297 7:105246281-105246303 ATGTTGCAGGGTGAGGGGGAGGG - Intronic
1031429647 7:121651330-121651352 CTGGAGCAGGAGCAAGGGGTAGG - Intergenic
1031876522 7:127147968-127147990 CTGGTTCAATGGCAAGGGGATGG - Intronic
1032263788 7:130356478-130356500 CTGGGGCTGGGGGAAGGGGATGG - Intronic
1033502585 7:141966539-141966561 CTGTTGCCAAGGCATGGGGAGGG + Intronic
1033681715 7:143601574-143601596 CTGAGGCAGGCGCAAAGGGAAGG - Intergenic
1033703176 7:143860239-143860261 CTGAGGCAGGCGCAAAGGGAAGG + Exonic
1033790306 7:144785117-144785139 CTGTCCCAGGGGAATGGGGAAGG + Intronic
1033923598 7:146427889-146427911 CTGTTGGAGGTACAGGGGGATGG - Intronic
1033939594 7:146635934-146635956 CTGTTCCAGTGGCAAGTGAATGG + Intronic
1034211627 7:149368683-149368705 CTGTTGTAGGGGGAGGGGGAGGG - Intergenic
1034406808 7:150909392-150909414 CTGAGGCAGAGGCAAGGGGCTGG + Intergenic
1034725444 7:153331371-153331393 CTGGGGCTGGGGCAAGGAGAGGG + Intergenic
1034855155 7:154538389-154538411 CTGTTGCAGGGGTCAGGAGGAGG - Intronic
1035309635 7:157957255-157957277 CTGTTGCTGTGGAGAGGGGATGG - Intronic
1035655444 8:1301772-1301794 CTGCTGCCGTGGGAAGGGGAGGG - Intergenic
1035784055 8:2248588-2248610 CTGTAGGAGGAGCCAGGGGAAGG + Intergenic
1036750092 8:11438242-11438264 GTCTTGCAGGGTCAAGGAGAAGG - Intronic
1036985196 8:13521245-13521267 CTGTTGGAGGGGCTTGGGGAGGG + Intergenic
1037260342 8:17001436-17001458 CAGTGGGAAGGGCAAGGGGAAGG + Intronic
1037374992 8:18217829-18217851 CTGTTGCAGGGGCTGGTGCAGGG + Intronic
1037637098 8:20710013-20710035 CTGTTGCGGGGGCAGGAGGAGGG - Intergenic
1037963305 8:23115789-23115811 CTGCTGCAGGGGGTAGGGGTGGG - Intronic
1037967711 8:23146768-23146790 CTGCTGCAGGGGGTAGGGGTGGG + Intronic
1038427379 8:27472632-27472654 TGGTTGCAGGGGCAGCGGGAAGG + Intronic
1038429733 8:27490857-27490879 CTACTGCAGGGGCGTGGGGAGGG + Exonic
1038512066 8:28147340-28147362 CTGATGCAGAGGTAAGGAGAGGG + Intronic
1038570495 8:28658048-28658070 CTGATGCAGGGGCACCGGGCAGG + Intronic
1039915258 8:41855737-41855759 CTGATGCCGGGGAAAGGAGAAGG - Intronic
1040516123 8:48136532-48136554 ATGTCTGAGGGGCAAGGGGAGGG - Intergenic
1040851265 8:51902381-51902403 TTTTTGCAGGGGGAGGGGGATGG - Intergenic
1041364644 8:57089133-57089155 CTGTTGGAGGGGTGGGGGGAGGG - Intergenic
1041703222 8:60815445-60815467 CTGTTTGAGGGGCAGGGAGAGGG + Intronic
1041713249 8:60911720-60911742 CCAGTGCAGAGGCAAGGGGAGGG + Intergenic
1041901993 8:62992620-62992642 CTATGGCATGGGCAAGGGAAGGG - Intronic
1042162504 8:65911760-65911782 CTGCTGCTGGGGCATGGGGGAGG - Intergenic
1042207947 8:66347827-66347849 CTGCTGCAGGGGAGAGGGGGAGG - Intergenic
1042282178 8:67066202-67066224 CTGTTGCTGGGGGAAAGAGAGGG - Intronic
1042785134 8:72537531-72537553 CTGTGGCGGCGGCAGGGGGATGG + Exonic
1043060840 8:75500842-75500864 ATTTTTCAGAGGCAAGGGGAGGG + Intronic
1043313866 8:78895728-78895750 ATGTTGCAGGAGCAGTGGGAGGG + Intergenic
1043464199 8:80487982-80488004 GTGTTGTGGGGGGAAGGGGATGG + Intronic
1043796395 8:84547113-84547135 CTGTTGGGAGGGCAAGAGGAGGG - Intronic
1045425765 8:102064376-102064398 CTGTTTCAGGGACATGGGGCTGG - Intronic
1045724889 8:105160765-105160787 CAGTGGCGGGGGCAAGGGGAAGG - Intronic
1048572810 8:135669273-135669295 CTGCTGCAGGGCCAGGCGGAGGG - Intergenic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1049238191 8:141523201-141523223 CTGGAGCAGGGGCAAGGAGAGGG - Intergenic
1049446670 8:142634531-142634553 CTGTGGCAGGGGCTAGGGTGGGG - Intergenic
1049569630 8:143363070-143363092 CTGTTTGTGGGGCCAGGGGAGGG - Intergenic
1049684481 8:143933876-143933898 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
1049744243 8:144256452-144256474 GTGGTGCTGGGGCAGGGGGAGGG - Intronic
1049771220 8:144382906-144382928 CTGGTGCAGGGGCTCAGGGAAGG + Intronic
1049888103 9:41826-41848 CTGTTGTGGGGGTGAGGGGAGGG - Intergenic
1050265655 9:3886954-3886976 CTGATGCAGAGGCAGGGGAAGGG - Intronic
1050537211 9:6641282-6641304 CTGCTGCTAGGGCAAGGGAAGGG - Intronic
1051585930 9:18726889-18726911 CTGGGGCTGGGGCAGGGGGAGGG - Intronic
1052282596 9:26750276-26750298 CGGTTGCCAGGGCAGGGGGAAGG - Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1053448845 9:38175963-38175985 CTCTTGCTGGGGCAAAGAGAGGG - Intergenic
1054876202 9:70098734-70098756 CTGGTGCAGGGGAAAAGGCATGG + Intronic
1055580807 9:77704541-77704563 CTGTTGGAGGAGTAGGGGGAAGG + Intergenic
1057181266 9:93031925-93031947 CAGCTGCAGGGGCCAGAGGAGGG + Intronic
1057311081 9:93943697-93943719 CTGAGGCAGGGGCAGGGGCAGGG - Intergenic
1059428408 9:114235672-114235694 CAGGGGCAGGGGCAGGGGGAGGG - Intronic
1059446149 9:114339249-114339271 CGGCTGCAGGGGCTATGGGACGG + Intronic
1060390155 9:123269875-123269897 CTGAAGGAGGGGCAAAGGGAAGG - Intergenic
1060420361 9:123464567-123464589 CAGTAGCTGGGGCAGGGGGAAGG + Intronic
1060931231 9:127490796-127490818 CTGTTGCAGGGGAGAGCAGAGGG - Intronic
1062454688 9:136629937-136629959 CTGTTGCAGGGGGGAGGGGAGGG + Intergenic
1062506986 9:136882609-136882631 CTCCAGCAGGGGCAGGGGGAGGG - Intronic
1185652894 X:1661594-1661616 CAGATGCAGGGGCTAGGGGGCGG - Intergenic
1185652918 X:1661719-1661741 CAGGTGCAGGGGCTAGGGGGCGG - Intergenic
1186285315 X:8037611-8037633 CTACTGCAGGGGCAAGGAGATGG - Intergenic
1186679908 X:11862001-11862023 CTGGAGCAGGAGCAAGGGGTTGG + Intergenic
1187178247 X:16916624-16916646 CTGTTGGGGGGGGAGGGGGAGGG - Intergenic
1187206138 X:17183616-17183638 CTGTTGTAAGGTCCAGGGGAGGG - Intergenic
1188003830 X:25004442-25004464 CAGTAGCAGGGGCAGGGGCAGGG + Exonic
1190060880 X:47211025-47211047 CAGATGCAGGGGCTAGGAGAAGG - Exonic
1192123299 X:68476955-68476977 CAGTTGGAGGGGCATGGGGCTGG - Intergenic
1192220260 X:69192980-69193002 GTGTTGCAGGGGGAAGAGAAAGG - Intergenic
1192240346 X:69323397-69323419 CTGAGGCAGAGGCAAGGTGAGGG + Intergenic
1193650141 X:84122179-84122201 CTGCTGCTGGGGCATGGGGAAGG - Intronic
1193739213 X:85197964-85197986 TAGTGGCAGGGGCAAGGGGTGGG - Intergenic
1193772678 X:85605975-85605997 TTGTTTCAGGGGCAAGGCCAAGG - Intergenic
1194932184 X:99901546-99901568 CTGTTGCAGGGCCTGGGGGGTGG - Intergenic
1194989511 X:100531333-100531355 CTGTTGGAGGGGTAGCGGGAGGG - Intergenic
1195430398 X:104782792-104782814 CTGTTGCTGAGGCAAAGGGTTGG + Intronic
1196283950 X:113857910-113857932 CTGTTGGAGTGGCAGGGGGAGGG - Intergenic
1197850036 X:130848588-130848610 CTGTTGCCAGTGCAATGGGAGGG - Intronic
1197905413 X:131419694-131419716 CTGTGGGAGGGGTGAGGGGAGGG + Intergenic
1199185856 X:144913925-144913947 CTGTTGCAGGGGCTAGTACAGGG - Intergenic
1199393162 X:147305695-147305717 CTGTTGCTGGGGGATGGGGGAGG - Intergenic
1200034955 X:153321054-153321076 CTGTTGCAGGGGCTTGGATAGGG - Intergenic
1201537905 Y:15071051-15071073 CAGCTGGTGGGGCAAGGGGAGGG - Intergenic