ID: 917268126

View in Genome Browser
Species Human (GRCh38)
Location 1:173243369-173243391
Sequence GCTCTTAAGAGGACTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917268126_917268137 14 Left 917268126 1:173243369-173243391 CCCTCCACAGTCCTCTTAAGAGC No data
Right 917268137 1:173243406-173243428 CCTTGGGCAAGTGGATTTGCGGG No data
917268126_917268133 5 Left 917268126 1:173243369-173243391 CCCTCCACAGTCCTCTTAAGAGC No data
Right 917268133 1:173243397-173243419 CCCAGAACTCCTTGGGCAAGTGG No data
917268126_917268130 -3 Left 917268126 1:173243369-173243391 CCCTCCACAGTCCTCTTAAGAGC No data
Right 917268130 1:173243389-173243411 AGCTTCAGCCCAGAACTCCTTGG No data
917268126_917268135 13 Left 917268126 1:173243369-173243391 CCCTCCACAGTCCTCTTAAGAGC No data
Right 917268135 1:173243405-173243427 TCCTTGGGCAAGTGGATTTGCGG No data
917268126_917268131 -2 Left 917268126 1:173243369-173243391 CCCTCCACAGTCCTCTTAAGAGC No data
Right 917268131 1:173243390-173243412 GCTTCAGCCCAGAACTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917268126 Original CRISPR GCTCTTAAGAGGACTGTGGA GGG (reversed) Intergenic
No off target data available for this crispr