ID: 917274559

View in Genome Browser
Species Human (GRCh38)
Location 1:173318471-173318493
Sequence GGTAGGCATTCTTAAGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917274555_917274559 8 Left 917274555 1:173318440-173318462 CCATTATCAGTTCACTAATGGAG No data
Right 917274559 1:173318471-173318493 GGTAGGCATTCTTAAGGTCAAGG No data
917274553_917274559 15 Left 917274553 1:173318433-173318455 CCTAAAGCCATTATCAGTTCACT No data
Right 917274559 1:173318471-173318493 GGTAGGCATTCTTAAGGTCAAGG No data
917274552_917274559 30 Left 917274552 1:173318418-173318440 CCTGAACAATTCACTCCTAAAGC No data
Right 917274559 1:173318471-173318493 GGTAGGCATTCTTAAGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917274559 Original CRISPR GGTAGGCATTCTTAAGGTCA AGG Intergenic
No off target data available for this crispr