ID: 917276498

View in Genome Browser
Species Human (GRCh38)
Location 1:173337230-173337252
Sequence AACAACTCTTGGCCTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917276494_917276498 14 Left 917276494 1:173337193-173337215 CCCTGCAATACTCCACAGATAAC No data
Right 917276498 1:173337230-173337252 AACAACTCTTGGCCTGCTACTGG No data
917276495_917276498 13 Left 917276495 1:173337194-173337216 CCTGCAATACTCCACAGATAACT No data
Right 917276498 1:173337230-173337252 AACAACTCTTGGCCTGCTACTGG No data
917276496_917276498 2 Left 917276496 1:173337205-173337227 CCACAGATAACTTCTCTTATTGA No data
Right 917276498 1:173337230-173337252 AACAACTCTTGGCCTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917276498 Original CRISPR AACAACTCTTGGCCTGCTAC TGG Intergenic
No off target data available for this crispr