ID: 917283107

View in Genome Browser
Species Human (GRCh38)
Location 1:173397826-173397848
Sequence CTAAGATACTTCAAGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917283099_917283107 27 Left 917283099 1:173397776-173397798 CCAAAAGCAACACAACCTTCCCA No data
Right 917283107 1:173397826-173397848 CTAAGATACTTCAAGGATGCAGG No data
917283103_917283107 7 Left 917283103 1:173397796-173397818 CCAGAGGAATTGCAGAGATTTGC No data
Right 917283107 1:173397826-173397848 CTAAGATACTTCAAGGATGCAGG No data
917283101_917283107 12 Left 917283101 1:173397791-173397813 CCTTCCCAGAGGAATTGCAGAGA No data
Right 917283107 1:173397826-173397848 CTAAGATACTTCAAGGATGCAGG No data
917283102_917283107 8 Left 917283102 1:173397795-173397817 CCCAGAGGAATTGCAGAGATTTG No data
Right 917283107 1:173397826-173397848 CTAAGATACTTCAAGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917283107 Original CRISPR CTAAGATACTTCAAGGATGC AGG Intergenic
No off target data available for this crispr