ID: 917284888

View in Genome Browser
Species Human (GRCh38)
Location 1:173413454-173413476
Sequence TTTTCAGCACTGAGAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917284888_917284892 9 Left 917284888 1:173413454-173413476 CCTCCCACTCTCAGTGCTGAAAA No data
Right 917284892 1:173413486-173413508 TCATGATCTAAGCTCAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917284888 Original CRISPR TTTTCAGCACTGAGAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr