ID: 917294640

View in Genome Browser
Species Human (GRCh38)
Location 1:173505895-173505917
Sequence CTCAAGTACAAGTAGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917294635_917294640 23 Left 917294635 1:173505849-173505871 CCATGAAGGAAATTGAGGGTCAG 0: 1
1: 0
2: 3
3: 38
4: 370
Right 917294640 1:173505895-173505917 CTCAAGTACAAGTAGGCACAGGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917294640 Original CRISPR CTCAAGTACAAGTAGGCACA GGG Intronic
900996470 1:6125913-6125935 CTCAAGTTCAAGCATGCCCAGGG + Intronic
902173761 1:14633985-14634007 CTCAAACACAGGTAGGCACCAGG - Intronic
904835400 1:33332352-33332374 CTCAAGAAGAAGTATGCACAGGG - Exonic
904990491 1:34588923-34588945 CTCAAGTTCTAGAAGGCACTGGG - Intergenic
905106955 1:35569381-35569403 CACAAGTACACATAGGAACATGG - Intergenic
906861465 1:49364777-49364799 GTTAAGTAAAAGTACGCACATGG - Intronic
908650414 1:66326924-66326946 CTCTTGGAAAAGTAGGCACAGGG - Intronic
910045041 1:82903291-82903313 CTCAGAAACAAGTAGGCACTTGG + Intergenic
911088684 1:94000824-94000846 CTCAAGTCCAAGTAAGCAGATGG - Exonic
917282457 1:173391565-173391587 CTCAAGACCAAGTATGAACAGGG - Intergenic
917294640 1:173505895-173505917 CTCAAGTACAAGTAGGCACAGGG + Intronic
919672880 1:200353902-200353924 CCCAAGGACAAGGAGCCACAGGG + Intergenic
1068734524 10:60397607-60397629 TTCAAGGACAAGTAGGAAGAGGG - Intronic
1082649502 11:55771528-55771550 CTCAAGACAAAGCAGGCACAGGG - Intergenic
1095895746 12:47278836-47278858 GTAAAGTACAAAGAGGCACAAGG + Intergenic
1095995291 12:48077279-48077301 CAAAAGCAGAAGTAGGCACATGG - Intronic
1098781994 12:74699353-74699375 CTCAAGTATTAGGAGGCAAAGGG - Intergenic
1099554196 12:84090375-84090397 CTCAAGTGCACATAGGAACATGG - Intergenic
1101547793 12:105732963-105732985 CTCAACAACAAGCAGGGACAAGG - Intergenic
1104292947 12:127485817-127485839 CTTTAGAATAAGTAGGCACAAGG - Intergenic
1108251938 13:48576455-48576477 CTCGAGTACAAGGATGCTCAGGG - Intergenic
1112948528 13:104961115-104961137 TTCAAGTACATGCAGGGACAAGG - Intergenic
1114323899 14:21569960-21569982 CTCAGGTAGATGAAGGCACAGGG + Exonic
1114760334 14:25307492-25307514 CACAAATACAAGTAGCCATAGGG + Intergenic
1119621339 14:76134185-76134207 CCCATGCACAAGGAGGCACAAGG - Intergenic
1122802953 14:104240951-104240973 CCCTAGGACAAGTGGGCACATGG - Intergenic
1129028714 15:72603734-72603756 TTCCAGGACAAGTATGCACATGG - Intergenic
1129275828 15:74444622-74444644 CTCAACCACAAGTAGGCAGCTGG + Intergenic
1129670442 15:77605015-77605037 GGCAAGCACAAGTGGGCACACGG - Intergenic
1130626220 15:85518271-85518293 CTCAAGTAATAGTAGGTACCTGG + Intronic
1132329199 15:100999527-100999549 CCCAATTACATGTACGCACATGG - Intronic
1132396865 15:101480810-101480832 CTCATGTACAAGTACGTACGTGG + Intronic
1132506194 16:310343-310365 CTAAAGAACAGGCAGGCACAAGG - Intronic
1138380384 16:56597318-56597340 ATTAACTACAAATAGGCACAAGG - Intergenic
1138891148 16:61145630-61145652 ATCAAGTACAAGTAGGGCTAGGG - Intergenic
1142738927 17:1919128-1919150 CTCAAGTACACATAGTCACCAGG + Intergenic
1142894151 17:2963737-2963759 CTCAAGTACCAGTGGGTACCAGG + Intronic
1143405091 17:6671936-6671958 CTCAAAGACAAGCAGCCACAGGG - Intergenic
1144913035 17:18698746-18698768 CTTACGTACAAGTGGGCAGATGG - Exonic
1146539283 17:33680533-33680555 CTCTAGTACAGGCAGACACAGGG - Intronic
1148115024 17:45170452-45170474 GTCAAGAACAAGGAGGCACAAGG - Intergenic
1149027600 17:52047307-52047329 CTCTACTACAATGAGGCACAAGG + Intronic
1152494847 17:80663791-80663813 CTCAAGCAGAGGAAGGCACAAGG - Intronic
1160019307 18:75167910-75167932 CTCAAGTTCAAGGAGGAAGAGGG - Intergenic
1160115869 18:76078820-76078842 CTCATGTGCAAGTGTGCACAAGG + Intergenic
1160156553 18:76438343-76438365 CCCAAACACAAGTAGGCTCAGGG - Intronic
1161458042 19:4379817-4379839 CCAAAATACAAGTAAGCACAAGG - Intronic
1162795586 19:13085868-13085890 CTCAAGTACCACTAAGCACGTGG - Intronic
1167807000 19:51794180-51794202 CAGAAGTACAAGTAGCCACCTGG + Intronic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
936975680 2:118219319-118219341 CTCAAGTAGAAGGAGGCAGGAGG - Intergenic
939792258 2:146592432-146592454 CTGAAGTACAAAGAGGCAGAAGG + Intergenic
942345754 2:175001102-175001124 CACCAGTACAAGAAGGAACATGG + Intronic
942430454 2:175905894-175905916 CTCAATTACAAGTGAGAACATGG + Intergenic
946797173 2:223367640-223367662 CTCAAATGCAAGCAGCCACATGG + Intergenic
1169155819 20:3328671-3328693 CAGAAGTACAAGCAGGCACAAGG + Intronic
1176704878 21:10107788-10107810 CTCTAATAAAAGTAGGCAAATGG + Intergenic
1182090808 22:27593473-27593495 TACATGTACAAGTATGCACATGG + Intergenic
1182392250 22:30008251-30008273 ATCACCTACAAGTTGGCACAAGG - Intronic
954447166 3:50553000-50553022 CTCAAGTCCAAGTGGGGACTAGG + Intergenic
956044072 3:65176488-65176510 CTCAATTACAAGTAGCAAAATGG - Intergenic
957500372 3:81048991-81049013 AGCAAGCACAAGTAGACACATGG + Intergenic
957898190 3:86451290-86451312 CAGAAGTAGAAGTATGCACAGGG - Intergenic
962841206 3:139234584-139234606 CACATGTACATGTATGCACATGG - Intronic
962966797 3:140363346-140363368 CTTGACTACAAATAGGCACAAGG + Intronic
969706382 4:8794400-8794422 CTCAAGAACTAGAAGGAACAGGG + Intergenic
972341287 4:38154822-38154844 GCCAAGTAGAAGTTGGCACAAGG - Intergenic
981606404 4:146545736-146545758 ATCAAGTTGAAGTAGGCCCAAGG - Intergenic
986965362 5:13263960-13263982 CTCAAGTACAATGTGGTACATGG - Intergenic
993373718 5:87123285-87123307 CTCCAGGACAAGTAGCCTCAGGG - Intergenic
998523237 5:142819093-142819115 CTAGAGAAAAAGTAGGCACAGGG - Intronic
1005896328 6:30182178-30182200 AGCAAGGACAAGTAGCCACAGGG + Intergenic
1006168820 6:32081511-32081533 GTCCAGTACAAGGATGCACAGGG - Intronic
1007300056 6:40861151-40861173 CTCATGGAAAAGTAGGAACAAGG - Intergenic
1007320262 6:41023361-41023383 CTGCAGTACAGGGAGGCACAGGG + Intergenic
1009337192 6:62506307-62506329 ATCAAGTCCAAGCAGGCATAAGG + Intergenic
1012099098 6:95007566-95007588 CTCAGGTAGAAGTAGCAACATGG - Intergenic
1015408304 6:132862574-132862596 CTAAATTAGAAGTAGGAACAAGG - Intergenic
1021164871 7:17325183-17325205 CTCAAGTACCAGGAGACCCAAGG - Intronic
1021399286 7:20191290-20191312 CAGAAGTGCAAGTAGGCCCATGG - Intronic
1030041425 7:105453821-105453843 GTCAAGTTTAAGTAGTCACATGG + Intronic
1033129700 7:138735293-138735315 CTCAAGTACAGGTGGGGACAGGG - Intronic
1035037722 7:155906375-155906397 CTCCAGTACAGGCAGGCAAAAGG + Intergenic
1036815635 8:11900962-11900984 CTCATGTAGAAGTAGACAAATGG - Intergenic
1039278425 8:35956519-35956541 CTTTAGAATAAGTAGGCACAAGG - Intergenic
1039826548 8:41179025-41179047 TTAAAGTACATGTAGTCACATGG - Intergenic
1041756717 8:61321906-61321928 CTGGAGTACAAGTAGGAAGAGGG - Intronic
1047953276 8:129953362-129953384 CTCAAGTACAAGTTGGGACCAGG - Intronic
1051218330 9:14822392-14822414 CTATAGTCCAAGTAGGCACCCGG + Intronic
1052408689 9:28095253-28095275 CCCAATTAGCAGTAGGCACAGGG + Intronic
1055132441 9:72791868-72791890 TTCATCTACAAGGAGGCACAAGG - Exonic
1056083497 9:83122121-83122143 CTCTTGTACAAGGAGCCACAAGG - Intergenic
1056602007 9:88053792-88053814 CTTCAGTACAAGTAGCTACAGGG + Intergenic
1061065986 9:128277676-128277698 TTCCAGGACAAGTATGCACATGG + Intronic
1061158996 9:128882488-128882510 CTGAAGCACAAGGAGGCACAGGG - Exonic
1202789911 9_KI270719v1_random:77887-77909 CTCTAATAAAAGTAGGCAAATGG + Intergenic
1185650757 X:1646233-1646255 CCCCAGGTCAAGTAGGCACAGGG + Intergenic
1192795321 X:74420974-74420996 CTCAAGTCCAAGGAGGGACATGG + Intergenic
1193874464 X:86844236-86844258 CTCAAGAACAACTAGAAACAGGG - Intergenic
1201722498 Y:17116008-17116030 TTCAAGTACAATGAGACACAGGG - Intergenic