ID: 917295894

View in Genome Browser
Species Human (GRCh38)
Location 1:173518909-173518931
Sequence ACAACAGACAGGAATCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917295894_917295899 -2 Left 917295894 1:173518909-173518931 CCCCCAAGATTCCTGTCTGTTGT 0: 1
1: 0
2: 1
3: 21
4: 191
Right 917295899 1:173518930-173518952 GTTCAACCAAATACTAATCTAGG 0: 1
1: 1
2: 21
3: 95
4: 268
917295894_917295902 12 Left 917295894 1:173518909-173518931 CCCCCAAGATTCCTGTCTGTTGT 0: 1
1: 0
2: 1
3: 21
4: 191
Right 917295902 1:173518944-173518966 TAATCTAGGGACTGCAGTGAAGG 0: 1
1: 0
2: 9
3: 51
4: 232
917295894_917295903 13 Left 917295894 1:173518909-173518931 CCCCCAAGATTCCTGTCTGTTGT 0: 1
1: 0
2: 1
3: 21
4: 191
Right 917295903 1:173518945-173518967 AATCTAGGGACTGCAGTGAAGGG 0: 1
1: 0
2: 9
3: 44
4: 255
917295894_917295900 -1 Left 917295894 1:173518909-173518931 CCCCCAAGATTCCTGTCTGTTGT 0: 1
1: 0
2: 1
3: 21
4: 191
Right 917295900 1:173518931-173518953 TTCAACCAAATACTAATCTAGGG 0: 1
1: 0
2: 2
3: 18
4: 196
917295894_917295904 25 Left 917295894 1:173518909-173518931 CCCCCAAGATTCCTGTCTGTTGT 0: 1
1: 0
2: 1
3: 21
4: 191
Right 917295904 1:173518957-173518979 GCAGTGAAGGGACTTTGTAGTGG 0: 1
1: 0
2: 0
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917295894 Original CRISPR ACAACAGACAGGAATCTTGG GGG (reversed) Intronic
903897738 1:26620186-26620208 ACAACGGGGAGTAATCTTGGGGG - Intergenic
903965483 1:27086440-27086462 ACAAAAGGCAGGAATCTTGGAGG + Intergenic
905309695 1:37040889-37040911 ACCACCTACTGGAATCTTGGCGG - Intergenic
905323911 1:37136936-37136958 AAAACAGACTGCAATCCTGGAGG + Intergenic
908667434 1:66509154-66509176 ACAATAGACTGAAATCTTGAGGG + Intergenic
909901304 1:81139499-81139521 ATAACAGACATAAAACTTGGTGG + Intergenic
909905539 1:81190268-81190290 ACACTCCACAGGAATCTTGGGGG - Intergenic
911432738 1:97812898-97812920 AAAACAGACAGGTACTTTGGTGG + Intronic
911607596 1:99926163-99926185 ACAGAAGACAGCAATCTTGAGGG - Intergenic
915897842 1:159825277-159825299 ACAGCAGACAGGAATCCTTTAGG - Intergenic
916349312 1:163830795-163830817 ACAACAGACTGGAATGTAGTAGG - Intergenic
916852221 1:168715022-168715044 TCCACAGCCAGGATTCTTGGTGG - Intronic
917295894 1:173518909-173518931 ACAACAGACAGGAATCTTGGGGG - Intronic
917295917 1:173519103-173519125 ACAACAGACGGGAATATTGCGGG + Intronic
918004560 1:180529602-180529624 ACAACACAAAGGAATCATAGAGG + Intergenic
922045330 1:221939858-221939880 ACAACAGAGAAGAGTCTGGGGGG - Intergenic
923242671 1:232100726-232100748 ACATCTGACAGCATTCTTGGTGG + Intergenic
924452147 1:244187954-244187976 AAAAGATACAGGAACCTTGGTGG - Intergenic
1063138986 10:3240078-3240100 ACCACAGAGAGGAAACTGGGGGG - Intergenic
1065704840 10:28463233-28463255 ACAACAGAGATGAGTCTTGAGGG + Intergenic
1065781277 10:29170326-29170348 CCAAGAGGCAGGAATCCTGGAGG + Intergenic
1067361506 10:45584613-45584635 ACCAGGGGCAGGAATCTTGGAGG - Intronic
1071760595 10:88601305-88601327 GCAACCAACAGGAATTTTGGAGG + Intronic
1072344380 10:94488993-94489015 ACACCAGACAGGACATTTGGGGG - Intronic
1073884283 10:108019993-108020015 GGAACAGACAGCAATCTTTGAGG + Intergenic
1075077725 10:119362236-119362258 ACAAGGGACAGGAAGTTTGGTGG - Intronic
1076261275 10:129069018-129069040 ACAAAAAGCAGGTATCTTGGGGG - Intergenic
1076374993 10:129977651-129977673 AGAGGGGACAGGAATCTTGGGGG - Intergenic
1077773703 11:5248702-5248724 ACAACATACAGGGTTCATGGTGG - Intronic
1078272746 11:9811759-9811781 ACAAGAGGCAGGATGCTTGGAGG + Intronic
1079580084 11:22053324-22053346 ACAACATACCGGAATCTCTGGGG - Intergenic
1081223494 11:40491877-40491899 CCAGGAGACAGGAAACTTGGAGG + Intronic
1081682793 11:45020230-45020252 ACAAATGACAGGAAAATTGGAGG + Intergenic
1081985034 11:47295588-47295610 ACACCACACTGGCATCTTGGTGG + Intronic
1085927669 11:81040485-81040507 ACATCAGACTGGGATCTTGCAGG + Intergenic
1090759254 11:129821377-129821399 ACAACAGACAGGGACCGTGGAGG - Intronic
1090887699 11:130893712-130893734 ACAACAAAAAGGAAACCTGGGGG + Intronic
1092305468 12:7296217-7296239 ACAACAGAGACTATTCTTGGGGG - Intergenic
1094396360 12:30010466-30010488 TGAACAGGCAGGAATCTTTGTGG - Intergenic
1095872558 12:47046300-47046322 ACAAGAGACAATAATCTAGGAGG - Intergenic
1096233733 12:49912098-49912120 ACAAGAGACAGTGATGTTGGGGG + Intergenic
1096893693 12:54798078-54798100 ACAACACAAAGGAGTTTTGGGGG - Intergenic
1098600360 12:72324219-72324241 AAAACTGACAGGAATCTTAGAGG + Intronic
1099846324 12:88032314-88032336 ACAACACATAGGAATTCTGGTGG + Intronic
1099950245 12:89293909-89293931 CCAAGGGGCAGGAATCTTGGAGG + Intergenic
1100422680 12:94452682-94452704 AGAAAAGGCAGGAATTTTGGTGG + Intronic
1100913179 12:99388629-99388651 ACAAGAGTCAGGAGTCTGGGTGG + Intronic
1103258074 12:119560510-119560532 AGAACATACAAGTATCTTGGTGG - Intergenic
1103314548 12:120042065-120042087 ACCACAGTCAGTAGTCTTGGTGG + Intronic
1106568663 13:30907468-30907490 ACAACAGTCAAGCATCCTGGGGG - Intronic
1106644497 13:31617685-31617707 ACAGGAGACAGGAGACTTGGGGG + Intergenic
1111639305 13:90947353-90947375 ACCACAGCCAGGAATCTTCTCGG - Intergenic
1111661324 13:91216087-91216109 AGGACAGTCAGGAATCTGGGTGG - Intergenic
1113730839 13:112640429-112640451 ACAACAGACAAAAAGCTTGGCGG + Intergenic
1114659605 14:24335840-24335862 ACAACAGGAAGGAATCCTAGAGG - Intronic
1115170994 14:30506760-30506782 ACAACAGTCAGTAAACTTGAGGG - Intergenic
1118327499 14:64791586-64791608 AAAAAAGACAGGAATGTTGAGGG + Intronic
1119514000 14:75233755-75233777 CCAGGAGACAGAAATCTTGGAGG + Intergenic
1119706104 14:76783476-76783498 ACAACAGAGAGGAAGAGTGGGGG - Intergenic
1121639533 14:95475860-95475882 CCAACAGGCAGGAATGTAGGGGG + Intergenic
1121819092 14:96951477-96951499 GCAACTGACAGGAAGCTAGGAGG + Intergenic
1125098027 15:35876976-35876998 ACCGCAGATAGGAATGTTGGAGG - Intergenic
1125638569 15:41210285-41210307 ACAACTGAAAGGAATATAGGTGG + Intronic
1127957788 15:63868213-63868235 AAACCAGACAGGACACTTGGTGG + Intergenic
1128634966 15:69297344-69297366 ACAGCAGGCAGGAATCCAGGTGG + Intergenic
1129133124 15:73518717-73518739 ACAACAGACAGCTATTTTAGCGG + Intronic
1129271383 15:74421057-74421079 GCACCAGACAGGACTCTGGGTGG + Intronic
1132151635 15:99466249-99466271 GCAACAGAAAGGATTCTTGTAGG + Intergenic
1132393913 15:101458505-101458527 ACAACAGTCAGGAGCCTTGCTGG - Intronic
1133877158 16:9745877-9745899 AGAAGAGTCAGGAATCCTGGGGG - Intergenic
1134561824 16:15217416-15217438 TCAACAGACTGGAAGCTTTGCGG - Intergenic
1134922362 16:18129040-18129062 TCAACAGACTGGAAGCTTTGCGG - Intergenic
1138224316 16:55279448-55279470 ACAAGAGACAGGAAGCCTGCTGG + Intergenic
1145312463 17:21708100-21708122 ACAGCAGACAGCAAGCCTGGGGG - Intergenic
1148237628 17:45979910-45979932 ACAGCAGCCTGGAATCATGGAGG + Intronic
1148867817 17:50638198-50638220 AGAACAGAGAGGAATCCTGCAGG - Intronic
1150150468 17:62804753-62804775 ACAACAAACAGGAATAGTGTGGG - Intronic
1151216995 17:72583789-72583811 AGAACCGACAGGAGCCTTGGGGG + Intergenic
1151440159 17:74123341-74123363 AAAACAGACAGGGATCTTCATGG - Intergenic
1152493396 17:80653453-80653475 AAAACACACAGGAATCTTAAGGG - Intronic
1152987888 18:336142-336164 ACAACAGAGAGGAAGCTTACAGG - Intronic
1152992204 18:373733-373755 ATACCAGACAGAATTCTTGGGGG - Intronic
1153772581 18:8427502-8427524 ACAACATAGAGGAACCTTGAAGG - Intergenic
1154473446 18:14726531-14726553 AAAACAGCCAGGAATGGTGGTGG - Intergenic
1155320122 18:24610948-24610970 ACGAGAGACAGGAGCCTTGGAGG + Intergenic
1158445158 18:57513630-57513652 GAAACAGAAAGGAATCTCGGGGG - Intergenic
1160737203 19:668582-668604 GCAACAGACATGAGTCTTGCTGG - Intergenic
1163353249 19:16792890-16792912 AAAAAAGAAAGGAATCATGGTGG + Intronic
1164736694 19:30546293-30546315 ACCAATGACAGGAATCTAGGAGG - Intronic
1165247616 19:34506206-34506228 TCCACAGCCAGGAATCTTGACGG - Exonic
1168383282 19:55942300-55942322 ACAACAAACTGGAATATTTGGGG + Intergenic
925391218 2:3495519-3495541 ACCGCAGACAGGCATCTTGGAGG - Intergenic
925805869 2:7647169-7647191 AGAGAAGAAAGGAATCTTGGAGG - Intergenic
927158323 2:20235185-20235207 AAAATAGCCAGGCATCTTGGCGG + Intergenic
928884394 2:36131585-36131607 ACAAGGGACAGGGATGTTGGTGG - Intergenic
932796931 2:74703937-74703959 AACACAGACACGAACCTTGGGGG + Intergenic
933296536 2:80497567-80497589 ACAGGGGACAGAAATCTTGGGGG - Intronic
933809945 2:86026963-86026985 ACAACAGACAAGATTCCTGGGGG - Exonic
935591106 2:104845812-104845834 ACAAATCACAGGAATGTTGGGGG + Intergenic
941560601 2:167040148-167040170 AAAATAGACAGGAATATTTGAGG + Intronic
943513165 2:188851554-188851576 ACAACAGCCAGGGATCTCTGAGG + Intergenic
944036279 2:195298219-195298241 ACAACAGTCAGTAATCCAGGAGG + Intergenic
944370195 2:198973717-198973739 ACAACAGACAGGGATGTTTGGGG + Intergenic
945859409 2:215103835-215103857 ACATTAGCCAGGTATCTTGGTGG + Intronic
948352063 2:237348982-237349004 AGAATTGACAGGAATCTTGATGG + Intronic
1170272283 20:14540649-14540671 ACAAAAGACAGGGATGTTGCTGG + Intronic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1174751843 20:53118754-53118776 ACACCAGAAAGGCATCTTGGTGG + Intronic
1174865017 20:54127357-54127379 GCTACACACAGGAATCTTTGAGG - Intergenic
1175906728 20:62383793-62383815 AAAACTGACAGGAATCATGTTGG - Intergenic
1176801038 21:13431335-13431357 AAAACAGCCAGGAATGGTGGTGG + Intergenic
1177488992 21:21796967-21796989 ACAGTAGACATGAATTTTGGGGG - Intergenic
1178368985 21:32011448-32011470 CCAGCAGACATGAATTTTGGAGG + Intronic
1179055162 21:37925009-37925031 ACAAGGGATAGGAATATTGGGGG + Intergenic
1180860743 22:19080222-19080244 ACAACAGAGGGGAGTCGTGGAGG - Intronic
1182067585 22:27441684-27441706 AGAACAGAACGGAATCTTTGTGG - Intergenic
1183699629 22:39443759-39443781 ACAACAGGAAGAAATCTTGCTGG - Intergenic
1184956262 22:47888648-47888670 AGAACGGACAGGAGTCCTGGAGG + Intergenic
949228157 3:1718744-1718766 ACAACATGCATGAACCTTGGGGG - Intergenic
949620955 3:5811104-5811126 AAAGCTGACAGGAATCCTGGGGG - Intergenic
950335647 3:12190684-12190706 ACAACAGTCAGCCAGCTTGGTGG + Exonic
955586099 3:60479851-60479873 TCAACAGACAGGGGTCATGGGGG - Intronic
956515293 3:70039800-70039822 GCAAGGAACAGGAATCTTGGTGG + Intergenic
960548220 3:118942810-118942832 ACAAGAGACAGGAAGCCTGTTGG - Intronic
961043986 3:123696310-123696332 ACAACAGGAAGGCATCCTGGAGG + Intronic
962079740 3:132125180-132125202 ACTACAGACATGACTCTTGCAGG + Intronic
966936055 3:184710492-184710514 ACAACAGACAAAAGTGTTGGGGG + Exonic
968009384 3:195263684-195263706 AAAACAGACAAGGATCATGGGGG + Intronic
970340873 4:15105365-15105387 ACTAGGGCCAGGAATCTTGGAGG + Intergenic
971216403 4:24666087-24666109 ACAACCGACAGGACACTTGGAGG - Intergenic
971446705 4:26758079-26758101 ACAACAGAGAAAAATTTTGGGGG - Intergenic
972431870 4:38990656-38990678 GAAACAGACAGAAATCTGGGGGG + Intronic
973603466 4:52564068-52564090 ACATCAGACAGGAGTCTTCTTGG + Intergenic
974216189 4:58850644-58850666 ACAACATACCGGAATCTCTGGGG - Intergenic
974781920 4:66562938-66562960 CCAAGGGACAGGAATCTTGAAGG + Intergenic
976716030 4:88122967-88122989 AAAACAGGCAGCAATCTTTGGGG + Intronic
977652100 4:99482379-99482401 ACAACATATAAGAATCTTTGGGG - Intergenic
978770893 4:112455672-112455694 CCAACAGATAAGAATCTTGGGGG + Intergenic
980134114 4:128844139-128844161 ACATCAGAAAGGTATTTTGGGGG - Intronic
985036934 4:185849801-185849823 ACGACAGACAGGAATGTTGATGG + Intronic
986831430 5:11583361-11583383 AGAACAGGCAGAAATCTAGGAGG + Intronic
986899848 5:12418186-12418208 CTAACAAACAGGAATCTTTGAGG - Intergenic
987638849 5:20584920-20584942 ACAACATAAATGAATCTTGAGGG + Intergenic
989723685 5:44561105-44561127 CCAGAGGACAGGAATCTTGGGGG - Intergenic
989733647 5:44676934-44676956 ACAAGAGGCAGAAAACTTGGAGG + Intergenic
992069645 5:73136900-73136922 CCTACATAAAGGAATCTTGGAGG - Intergenic
992116638 5:73544611-73544633 ATAACAGACATGCATCATGGAGG + Intergenic
994038406 5:95229084-95229106 AAAAAACACAGGAAGCTTGGAGG + Intronic
995102119 5:108324829-108324851 ACAACATAGATGAATCTTGAGGG + Intronic
999531346 5:152466479-152466501 TAAATAGCCAGGAATCTTGGAGG + Intergenic
999572517 5:152936755-152936777 ACCACAGGAAGGAAACTTGGGGG + Intergenic
1000958120 5:167566328-167566350 ACAACAGACAGACATTCTGGAGG - Intronic
1001220704 5:169898093-169898115 ACAACACACAAGAAGGTTGGTGG - Intronic
1004255391 6:14058621-14058643 ACAACATGAAGGAATTTTGGGGG + Intergenic
1004822317 6:19381173-19381195 GCAACCTACAGGAAACTTGGAGG - Intergenic
1006813102 6:36833339-36833361 CCACGAGACTGGAATCTTGGAGG - Intronic
1010459177 6:76094412-76094434 ACAACACATAGGAATTATGGGGG - Intergenic
1012276725 6:97283140-97283162 ACCACCAACAGGAATCTTTGGGG + Exonic
1013463616 6:110398940-110398962 ACAACATTCAGGAAACTGGGTGG - Intronic
1013718707 6:112995874-112995896 ACAACATTCAGGAAACTTGAGGG - Intergenic
1014622715 6:123688928-123688950 ACATCAGACAGGAATCTTCAAGG - Intergenic
1015215055 6:130740592-130740614 ACAACATGAATGAATCTTGGAGG - Intergenic
1016548639 6:145252325-145252347 ACAAAATACAGGAATTTTGGAGG - Intergenic
1017591137 6:155979109-155979131 CCAGAAGACAGGAATCTTGGAGG - Intergenic
1021397103 7:20164084-20164106 ACATCAGACAGGACTGGTGGTGG - Intronic
1022037001 7:26543998-26544020 ACATCAGACAGAAAACATGGAGG + Intergenic
1022166658 7:27771718-27771740 ATGACAGTCACGAATCTTGGAGG + Intronic
1026865822 7:73823392-73823414 ACACCAGGCAGGATTCCTGGAGG - Intronic
1031957890 7:127960676-127960698 TCAACACAAAGGAATCATGGTGG - Intronic
1032148450 7:129405846-129405868 ACAACAGACATGATGTTTGGTGG + Exonic
1032390696 7:131553683-131553705 GCAACAGAAAGGCAGCTTGGTGG - Intronic
1033359301 7:140626751-140626773 ACAAAAGGCAGCAATCTTAGAGG + Intronic
1033734673 7:144209731-144209753 ACAACAGAGATGGATCTTGGAGG - Intergenic
1033748380 7:144341238-144341260 ACAACAGAGATGGATCTTGGAGG + Intergenic
1034359121 7:150478416-150478438 GAAACAGACATGAGTCTTGGAGG + Exonic
1035561646 8:608575-608597 TCCAAAGACAGGAATTTTGGTGG - Intergenic
1035841748 8:2819727-2819749 AAAAGAAACAGGAAACTTGGAGG + Intergenic
1038498389 8:28023531-28023553 ACAAGTGACAGGATTGTTGGGGG - Intronic
1040361282 8:46666651-46666673 ACAACAGAGAGGAACCTTGAAGG + Intergenic
1041104960 8:54432891-54432913 ACAACATCCATGAACCTTGGGGG + Intergenic
1041907094 8:63045576-63045598 ACAACATACTGGAATCTCTGGGG - Intergenic
1048220978 8:132541742-132541764 ACAATAGCATGGAATCTTGGGGG + Intergenic
1048591351 8:135823714-135823736 ACAACACATAGGAATTATGGGGG + Intergenic
1048760827 8:137793267-137793289 CCAAGAGGCAGGAACCTTGGGGG - Intergenic
1050793239 9:9501886-9501908 ACAACACAGAGAAAACTTGGTGG + Intronic
1051183728 9:14437953-14437975 ACAAGAGGCAGGACTCTGGGAGG - Intergenic
1051440931 9:17081842-17081864 ACGAGAGTCAGGATTCTTGGTGG + Intergenic
1051630175 9:19133601-19133623 ACAACAGCCTGGAAACTTGATGG + Intronic
1052847974 9:33354114-33354136 ATAACAGACATGCAGCTTGGAGG + Exonic
1052896927 9:33755897-33755919 ACAACAGACAGGGACCGTGGAGG - Intronic
1055532161 9:77194900-77194922 ACAACAGAGAGGAGTCAGGGTGG - Intronic
1055642792 9:78333547-78333569 ACAACAAACATTAATCATGGAGG - Intergenic
1055816305 9:80210819-80210841 GCACCAAACAGGAATCTTGGAGG + Intergenic
1055988015 9:82073085-82073107 ACAACAGACACCAATGGTGGAGG + Intergenic
1056039700 9:82651105-82651127 AAAACAAATAGAAATCTTGGAGG - Intergenic
1056041195 9:82669377-82669399 ATAACAGTCAGGAATCTTTGAGG - Intergenic
1058969525 9:110067891-110067913 AAAACAAACATGAAACTTGGAGG + Intronic
1059805255 9:117792484-117792506 GGAACAGAAAGGAATCATGGGGG + Intergenic
1062745861 9:138211668-138211690 AAAACGGACAGGAAAGTTGGGGG + Intergenic
1185733155 X:2477385-2477407 ACAACAGACAGGACTGTTACAGG + Intronic
1186059527 X:5689261-5689283 AGAAGAGACAGGAATAATGGAGG - Intergenic
1186596200 X:10984359-10984381 AGAATAGACAGGAATGTTGAAGG + Intergenic
1186751884 X:12629899-12629921 ACCAAAGAGAGGAATCTGGGTGG + Intronic
1187329498 X:18323932-18323954 ACAACAGAAATGATTTTTGGAGG - Exonic
1188409281 X:29851216-29851238 AAATCAGACAGGAGCCTTGGTGG - Intronic
1192947889 X:75985429-75985451 TCAACACACAGGCATATTGGGGG - Intergenic
1193784399 X:85741860-85741882 ACAACAGACTAGAATCTCTGAGG + Intergenic
1195665676 X:107428053-107428075 ACATGAGTCAGGAATCTTGGGGG + Intergenic
1196199799 X:112873076-112873098 AGAAAAGAAAAGAATCTTGGTGG - Intergenic
1196466117 X:115973070-115973092 ACAAGAGACAGTAGTCTAGGGGG + Intergenic
1197474449 X:126903456-126903478 ACAACATACTAGAATCTTTGGGG + Intergenic
1197825447 X:130585243-130585265 CCAAGGGCCAGGAATCTTGGAGG - Intergenic
1198039267 X:132833714-132833736 ACAACACACAGCAAACCTGGAGG + Intronic
1201960374 Y:19674504-19674526 ACAACATAAATGAACCTTGGAGG - Intergenic