ID: 917295894

View in Genome Browser
Species Human (GRCh38)
Location 1:173518909-173518931
Sequence ACAACAGACAGGAATCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917295894_917295902 12 Left 917295894 1:173518909-173518931 CCCCCAAGATTCCTGTCTGTTGT 0: 1
1: 0
2: 1
3: 21
4: 191
Right 917295902 1:173518944-173518966 TAATCTAGGGACTGCAGTGAAGG 0: 1
1: 0
2: 9
3: 51
4: 232
917295894_917295900 -1 Left 917295894 1:173518909-173518931 CCCCCAAGATTCCTGTCTGTTGT 0: 1
1: 0
2: 1
3: 21
4: 191
Right 917295900 1:173518931-173518953 TTCAACCAAATACTAATCTAGGG 0: 1
1: 0
2: 2
3: 18
4: 196
917295894_917295899 -2 Left 917295894 1:173518909-173518931 CCCCCAAGATTCCTGTCTGTTGT 0: 1
1: 0
2: 1
3: 21
4: 191
Right 917295899 1:173518930-173518952 GTTCAACCAAATACTAATCTAGG 0: 1
1: 1
2: 21
3: 95
4: 268
917295894_917295903 13 Left 917295894 1:173518909-173518931 CCCCCAAGATTCCTGTCTGTTGT 0: 1
1: 0
2: 1
3: 21
4: 191
Right 917295903 1:173518945-173518967 AATCTAGGGACTGCAGTGAAGGG 0: 1
1: 0
2: 9
3: 44
4: 255
917295894_917295904 25 Left 917295894 1:173518909-173518931 CCCCCAAGATTCCTGTCTGTTGT 0: 1
1: 0
2: 1
3: 21
4: 191
Right 917295904 1:173518957-173518979 GCAGTGAAGGGACTTTGTAGTGG 0: 1
1: 0
2: 0
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917295894 Original CRISPR ACAACAGACAGGAATCTTGG GGG (reversed) Intronic