ID: 917300905

View in Genome Browser
Species Human (GRCh38)
Location 1:173573111-173573133
Sequence CTGCTTCCTAATTCTAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917300900_917300905 8 Left 917300900 1:173573080-173573102 CCATGTCCAGAGCCCTTTTTGCT 0: 1
1: 0
2: 1
3: 22
4: 265
Right 917300905 1:173573111-173573133 CTGCTTCCTAATTCTAATTCTGG 0: 1
1: 0
2: 1
3: 16
4: 189
917300903_917300905 -5 Left 917300903 1:173573093-173573115 CCTTTTTGCTGTATGCCACTGCT 0: 1
1: 0
2: 2
3: 9
4: 206
Right 917300905 1:173573111-173573133 CTGCTTCCTAATTCTAATTCTGG 0: 1
1: 0
2: 1
3: 16
4: 189
917300902_917300905 -4 Left 917300902 1:173573092-173573114 CCCTTTTTGCTGTATGCCACTGC 0: 1
1: 0
2: 1
3: 19
4: 208
Right 917300905 1:173573111-173573133 CTGCTTCCTAATTCTAATTCTGG 0: 1
1: 0
2: 1
3: 16
4: 189
917300899_917300905 15 Left 917300899 1:173573073-173573095 CCTGGCTCCATGTCCAGAGCCCT 0: 1
1: 0
2: 7
3: 47
4: 314
Right 917300905 1:173573111-173573133 CTGCTTCCTAATTCTAATTCTGG 0: 1
1: 0
2: 1
3: 16
4: 189
917300901_917300905 2 Left 917300901 1:173573086-173573108 CCAGAGCCCTTTTTGCTGTATGC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 917300905 1:173573111-173573133 CTGCTTCCTAATTCTAATTCTGG 0: 1
1: 0
2: 1
3: 16
4: 189
917300898_917300905 22 Left 917300898 1:173573066-173573088 CCGGTTTCCTGGCTCCATGTCCA 0: 1
1: 0
2: 5
3: 35
4: 294
Right 917300905 1:173573111-173573133 CTGCTTCCTAATTCTAATTCTGG 0: 1
1: 0
2: 1
3: 16
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917300905 Original CRISPR CTGCTTCCTAATTCTAATTC TGG Intronic
906963371 1:50433038-50433060 ATGCCTCCTTTTTCTAATTCCGG + Intergenic
909200946 1:72689269-72689291 CTGGATCAAAATTCTAATTCTGG - Intergenic
910249350 1:85179254-85179276 GTGATTCCTAATTCAAATCCTGG - Intronic
910942412 1:92550976-92550998 CTGGTTCTTAATCTTAATTCTGG - Intronic
913013238 1:114706125-114706147 GTGCTTCTTACTGCTAATTCTGG - Exonic
915212055 1:154317664-154317686 CTGCATCAATATTCTAATTCTGG + Intergenic
915755802 1:158258024-158258046 CTGCTTCCCACTTGTAAGTCAGG - Exonic
916666801 1:166974581-166974603 CTGCTTTCTAATTATCATTTGGG + Intronic
917300905 1:173573111-173573133 CTGCTTCCTAATTCTAATTCTGG + Intronic
918122123 1:181549354-181549376 CTTCTTCCTCATTCTCACTCTGG - Intronic
918589712 1:186227310-186227332 CTGCATCAATATTCTAATTCTGG + Intergenic
919599087 1:199600260-199600282 TTGCTGCCTATTTCTTATTCTGG - Intergenic
919661676 1:200253782-200253804 CTGCTTCCCAATTCAAACCCTGG - Intergenic
920610636 1:207433504-207433526 ATGCTTCCAAATTCTCTTTCAGG - Intergenic
921106956 1:211991016-211991038 CTGCTACCAAGTTCTAGTTCAGG - Intronic
921993703 1:221394996-221395018 CTTCTTCCTGATTCCCATTCTGG + Intergenic
922519177 1:226232676-226232698 CTGTTTCCTAACTAAAATTCAGG - Intronic
923350034 1:233095540-233095562 CTGCTTCTTAATGCATATTCAGG - Intronic
923757882 1:236809901-236809923 CTGCTTCATACTTCAATTTCAGG + Intronic
924286650 1:242494181-242494203 TTCCTTCCTAATTCTAACTCGGG + Intronic
1064050491 10:12055512-12055534 CTGATTCCTAATCCTAGCTCTGG - Intergenic
1065442001 10:25762564-25762586 CTCCTTCCCAATTCCAACTCTGG + Intergenic
1066803993 10:39224541-39224563 CTGCTTTCTAGTTTTTATTCTGG - Intergenic
1068916121 10:62433609-62433631 CTGCTTCTTAAATCCAAATCTGG - Intronic
1069067493 10:63959058-63959080 CTGCTACCTACTTCCACTTCAGG - Intergenic
1070337715 10:75469952-75469974 CTCCTTCCTATTGCTGATTCAGG - Intronic
1073042296 10:100615800-100615822 ATATTTCCTAATTCTAATTCAGG - Intergenic
1074361529 10:112827446-112827468 CTGTTTCCTACATCTCATTCAGG + Intergenic
1074470877 10:113725623-113725645 CTGCTTCCATATTCAAATTAGGG + Intronic
1074470887 10:113725709-113725731 CTGCTTCCATATTCAAATTAGGG + Intronic
1075692632 10:124409254-124409276 CTGCTTTTAAATTCTAATTTTGG - Intronic
1081178279 11:39955704-39955726 GTGCTTCCTAATCCTAAAGCAGG + Intergenic
1081515942 11:43829736-43829758 CTCCTTCCTTATTCTGTTTCTGG + Intronic
1081720580 11:45285800-45285822 CCGCTCCCTAATTCTCCTTCAGG + Intronic
1082573541 11:54773296-54773318 CTTCTTTCTAGTTTTAATTCTGG - Intergenic
1085704073 11:78770383-78770405 CTGGGTTCTAATTCTAGTTCTGG - Intronic
1085707947 11:78803421-78803443 CTACTTACTAATTATAATTTTGG - Intronic
1087220491 11:95541807-95541829 CTTCCTCCTACTTCTAACTCTGG - Intergenic
1087642837 11:100773908-100773930 TTGCTTGCTAATTTTAAATCAGG + Intronic
1089007096 11:115101333-115101355 CTGCTTCCCAGTTCTGATTAAGG + Intergenic
1089170067 11:116505744-116505766 CTGATTCTTAATTATAGTTCTGG - Intergenic
1090795298 11:130130593-130130615 CTGGTTCCTACTTCTAATATTGG + Intronic
1093241986 12:16687943-16687965 TTCATTCCTAGTTCTAATTCAGG - Intergenic
1094593896 12:31846698-31846720 CTGTTTCCTGAGTCTTATTCTGG - Intergenic
1094797851 12:33997257-33997279 CTGGAACCAAATTCTAATTCAGG - Intergenic
1095257765 12:40059959-40059981 CTGTTTCCTGATCCTACTTCTGG + Intronic
1095431172 12:42136631-42136653 CTGTATCCTAATCCTAATTTTGG + Intronic
1096600806 12:52727444-52727466 ATGCTCCCTGATTCTGATTCAGG - Intergenic
1096679351 12:53244782-53244804 CTTCTCCCAAATTCTTATTCTGG + Intergenic
1098742786 12:74195442-74195464 CTGATTTCCAATTCAAATTCAGG - Intergenic
1098967956 12:76813684-76813706 CTGCTTGCTTAATGTAATTCAGG + Intronic
1099844417 12:88011696-88011718 CTGCTTCCAAAATCTAGTTCTGG + Intronic
1100278784 12:93097718-93097740 TTGCTTCCTAATTCTTCTTCTGG - Intergenic
1100649315 12:96567437-96567459 CAACTTCCTCATTCAAATTCTGG - Intronic
1103301356 12:119929848-119929870 CGGCCTCCAAATTCTACTTCTGG + Intergenic
1107222133 13:37995468-37995490 TTGCTTCCTCTTTCTAATTCAGG + Intergenic
1107521918 13:41191990-41192012 TTGCTTCCATATTTTAATTCTGG + Exonic
1110264846 13:73525625-73525647 CTTCTTCCAGATTCTAAGTCTGG - Intergenic
1111849761 13:93557879-93557901 CTGCTTTCTAATTCTAAATTAGG + Intronic
1112520794 13:100093342-100093364 CTTCTTCCAAATCCTAATTTAGG - Intronic
1114753970 14:25237668-25237690 CTGCTTCCTCATTCTTTTCCTGG + Intergenic
1116484307 14:45428231-45428253 CTCCATCCTAATTCGAATTGTGG + Intergenic
1116614568 14:47118489-47118511 CAGCTTTCAAATTCTAGTTCTGG + Intronic
1117432379 14:55680720-55680742 CTCCTTCAAAATGCTAATTCAGG + Intronic
1119431132 14:74568645-74568667 CTACTTCCTAATTTTAATGGTGG - Intronic
1120999793 14:90443440-90443462 CTGCCTCCTACCTCTAATGCTGG + Intergenic
1121248666 14:92483437-92483459 CTGGGTCCTAATCCTAACTCTGG - Intronic
1121257386 14:92540633-92540655 CTGCTTCCTAGTTCTACCTCTGG - Intronic
1124829414 15:33133494-33133516 CTGTTTCCTAATTCTGGCTCTGG + Intronic
1125038215 15:35151732-35151754 CAGCTTTCTTATTCTAGTTCAGG - Intergenic
1125209389 15:37195584-37195606 CTTCTTCCTCATTCTTTTTCTGG + Intergenic
1125441924 15:39712148-39712170 CTGCTGCCTAACTCTCATTAGGG + Intronic
1125684208 15:41553836-41553858 CTGCTTCCTAAATCTGCTTTTGG + Intergenic
1126225008 15:46260938-46260960 TTGATTTCTAATTCTAACTCTGG + Intergenic
1126726254 15:51635485-51635507 CTGGTTCAGTATTCTAATTCTGG - Intergenic
1126737067 15:51741089-51741111 CTCCTTCCTAATTCTTCCTCAGG - Intronic
1129978293 15:79842287-79842309 CTCCTTCCTAATTCTTCTTCAGG - Intronic
1132200901 15:99954147-99954169 ATGATTCCCAATTCTCATTCCGG - Intergenic
1132321584 15:100929544-100929566 CTATTTCCTAGTTCTATTTCTGG - Intronic
1137036301 16:35572796-35572818 CTGCTTGCCAATTCTAAACCTGG - Intergenic
1139047468 16:63079662-63079684 CTGCTTTTTAAATCTAACTCAGG + Intergenic
1141291062 16:82718426-82718448 TTACTTCCTACTTCTACTTCAGG - Intronic
1141436635 16:84003390-84003412 CTTCTTCCTATTTCTCAGTCCGG + Intergenic
1142542599 17:671975-671997 CTTTTTCCCAATTCTCATTCTGG - Intronic
1142932023 17:3293267-3293289 CTGCTTCTTGAGTCCAATTCAGG - Intergenic
1143385677 17:6529024-6529046 CTGCATGCTAATTCTCATCCTGG + Intronic
1144961106 17:19044681-19044703 CTGGTTCCTTCTTGTAATTCGGG - Intronic
1144974055 17:19129843-19129865 CTGGTTCCTTCTTGTAATTCGGG + Intronic
1147863601 17:43538577-43538599 CTGATTTCTAGTTCTTATTCTGG + Intronic
1148672664 17:49422691-49422713 CTCCTTTCTCATTCTCATTCAGG + Intronic
1151452684 17:74208403-74208425 CTGCTGCCAAGTTCTATTTCAGG - Intronic
1153008788 18:519263-519285 CTGCTTCACATTTCTCATTCGGG - Intergenic
1157978365 18:52352103-52352125 CTGCTTCCCAACTCTAAATTGGG + Intronic
1160107189 18:75989083-75989105 CTGCTTCCTAGAACTACTTCTGG + Intergenic
1161729021 19:5947556-5947578 CTGCTTCCTTATTATTACTCTGG - Intronic
1167213059 19:48145642-48145664 CTGCTGCCTCATTGTAATGCCGG - Intronic
1202711270 1_KI270714v1_random:20599-20621 CTGCTTCCTAATTGTATGTGGGG - Intergenic
926918031 2:17911960-17911982 CAGCTTCCTTATACTAAGTCTGG - Intronic
927679197 2:25129059-25129081 TTGCTTCCTGATGCTATTTCAGG + Intronic
930749831 2:54923764-54923786 CTGCTTCCTCATACTCCTTCTGG + Intronic
931953486 2:67391710-67391732 CTGCTTCATAATTTTAATGAGGG + Intergenic
935887538 2:107638426-107638448 CTGCTTTCTAAATCAAATCCTGG + Intergenic
936248111 2:110846148-110846170 CTGCTTCCAAATTCCAAATCTGG - Intronic
936341294 2:111634753-111634775 TTTCTTCCTAATTCTTTTTCTGG - Intergenic
937595701 2:123669771-123669793 CTTCTTCTTAAATCTAATTGAGG + Intergenic
940895121 2:159074071-159074093 CTGCGTTCTAACTCTGATTCTGG - Intronic
941517716 2:166500203-166500225 TTGCTTGATAATTCTAATTTAGG - Intergenic
941991458 2:171561243-171561265 CTTTTTCCTTCTTCTAATTCTGG + Intergenic
942382776 2:175409481-175409503 CCGTTTCCAAATTCTAATCCAGG + Intergenic
943556361 2:189409908-189409930 TTGCTTTATAATTATAATTCAGG + Intergenic
943805730 2:192122903-192122925 ATGCTTCCTAATTGCATTTCTGG - Intronic
945602603 2:211887209-211887231 CTGTTCACTAATTCTAATTCAGG - Intronic
1170265039 20:14457151-14457173 TTTCTTCCTACTTCTAATTCAGG + Intronic
1171347044 20:24473396-24473418 CAACTTCATTATTCTAATTCTGG - Intronic
1178951025 21:36985832-36985854 ATGTTTCCTAAATCCAATTCAGG + Intronic
1181737904 22:24896248-24896270 TTGCTTCCTAATTTTGATTTTGG + Intronic
1182164036 22:28154222-28154244 CTTCTTTCTCATTCTAATTTAGG - Intronic
949975164 3:9450030-9450052 CTTCTTGATAATTCTAATGCTGG + Intronic
951654006 3:24983994-24984016 ATTCTTACTAATTCTAATTTAGG + Intergenic
952115016 3:30168500-30168522 CAGCTTCAGAATTTTAATTCAGG - Intergenic
952519482 3:34142238-34142260 CTGTTTCCTATTTTTAATTTTGG + Intergenic
954515861 3:51175811-51175833 CTGCTTCCTACTTATAAGTCAGG + Intronic
954933748 3:54307663-54307685 CAGGTTCCTAACTCTCATTCTGG + Intronic
955074399 3:55600044-55600066 CTCCTTGCTACTTCTAATGCTGG - Intronic
955090780 3:55748627-55748649 CTGTTTCCCAATTCAAATGCTGG + Intronic
955591213 3:60537845-60537867 CTACTTCATTTTTCTAATTCGGG + Intronic
956377475 3:68631059-68631081 CTGGTTTCAAATTCTAATTCTGG - Intergenic
956565319 3:70630666-70630688 CTGCTTCTTCATTCTGATGCTGG - Intergenic
956647316 3:71468947-71468969 CTGGGTCCAAATTCTCATTCAGG - Intronic
958152238 3:89705243-89705265 CTGCTACCCAATTCCATTTCAGG + Intergenic
962050728 3:131812139-131812161 CTGCATCCTAATTGCAATCCTGG - Intronic
962734308 3:138310878-138310900 TTGCTTCCTAGTACTAATTGGGG - Intronic
964447250 3:156772501-156772523 CTGATTCAGAATCCTAATTCTGG - Intergenic
964807530 3:160627886-160627908 CTGCTTCCTAATTCAAAGAATGG + Intergenic
964895901 3:161594628-161594650 CTGATTCCAAATTCTAATTCAGG - Intergenic
965375230 3:167914902-167914924 CTGCTCACTAATTCTGATTAAGG + Intergenic
966998046 3:185303844-185303866 TTCCTTCCTAATACTAATACTGG + Intronic
971868490 4:32204641-32204663 CTGCCTCCAAATTTTAATTGGGG + Intergenic
972155430 4:36155416-36155438 CTGGTTCCTTCTTCTTATTCAGG - Intronic
973149744 4:46872588-46872610 TTGCTTCTTAATTCTATCTCAGG + Intronic
977529057 4:98178240-98178262 CAGATTCCTAATTATCATTCAGG + Intergenic
981196604 4:141928496-141928518 CATCTGCATAATTCTAATTCTGG - Intergenic
981244512 4:142518432-142518454 CTGTATCTTAATTATAATTCAGG - Intronic
983266958 4:165517464-165517486 CTGCCTCCTACTACTCATTCTGG - Intergenic
983350990 4:166588234-166588256 CTGATTCCCAATTCAACTTCTGG + Intergenic
986194189 5:5522651-5522673 CTTCTTGCTGATTCTAATTTTGG + Intergenic
986285291 5:6354468-6354490 CTGCTTCCTGCTTCTATGTCTGG - Intergenic
986879676 5:12154292-12154314 CTGCTTCCTGCTTCTTCTTCTGG - Intergenic
990692716 5:58381757-58381779 CTGAATCAAAATTCTAATTCTGG + Intergenic
991414473 5:66378561-66378583 CTGCTTCCTATTTGTCATCCTGG - Intergenic
992013666 5:72555651-72555673 CTGATTGCAAAATCTAATTCAGG + Intergenic
993127904 5:83858180-83858202 AAGCTTTCTAATTCTAACTCTGG + Intergenic
994995619 5:107058760-107058782 CTGCTTGCTCATTCTAAGTCTGG - Intergenic
996999768 5:129745942-129745964 CTACCTCCTAATTGTCATTCAGG - Intergenic
997710611 5:136001121-136001143 CTGCTTCCTCATCCGAATTGTGG - Intergenic
998361023 5:141587162-141587184 CTCCTTCTTAATTCTCATGCTGG + Exonic
998876102 5:146600989-146601011 CTACTTTCTGATTCTCATTCTGG + Intronic
1000011423 5:157236889-157236911 CTGCAGCCAAATTCTCATTCTGG + Intronic
1001257606 5:170196302-170196324 GTGCTTCCTAATCCCATTTCTGG + Intergenic
1001840185 5:174869270-174869292 GTGGTTCCTAATTTTAATTTTGG + Intergenic
1007598546 6:43066999-43067021 CAGCTTCCTTATACTTATTCTGG - Exonic
1008259491 6:49347474-49347496 CTGCTGGCTAGTCCTAATTCTGG + Intergenic
1009393786 6:63173225-63173247 CTCCTTCATAATTGTACTTCTGG + Intergenic
1010118365 6:72342290-72342312 CTGCGTGCTAAATCTAATTGTGG - Intronic
1010751660 6:79622192-79622214 CTGCTTCCCAAATCTGCTTCTGG - Intergenic
1010807024 6:80249356-80249378 CTGCTTCCTAAATATCAGTCAGG - Intronic
1011295737 6:85825311-85825333 CTGCTTCCTAACTTAGATTCAGG + Intergenic
1011820782 6:91251450-91251472 CTGTGTTCAAATTCTAATTCTGG + Intergenic
1014192002 6:118506952-118506974 CTGTTTCCTGTTTCTAGTTCTGG + Intronic
1014711619 6:124812903-124812925 CATTCTCCTAATTCTAATTCAGG + Intronic
1015408305 6:132862575-132862597 CTTGTTCCTACTTCTAATTTAGG + Intergenic
1016095224 6:140028814-140028836 CTGCTTTGTAATTCTCATTGTGG + Intergenic
1016301275 6:142634569-142634591 CTGTTGCATAATTCTTATTCCGG - Intergenic
1018503334 6:164437240-164437262 ATGCTTCTAAATTCTACTTCAGG - Intergenic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1024927749 7:54635826-54635848 CCTCTTCCTAATTCTTGTTCGGG + Intergenic
1027753054 7:82176089-82176111 CTGCTTTCTTATTCTATTTGTGG - Intronic
1029882457 7:103829824-103829846 ATGCTTCCTAATTCTTACTACGG + Intronic
1029962569 7:104704308-104704330 CTGCTTCAAAATTTTAGTTCCGG + Intronic
1037621259 8:20565558-20565580 CTCCTTCTTAATACTACTTCTGG + Intergenic
1038606529 8:29011570-29011592 GTCCTTCCTATTTCTAGTTCAGG - Intronic
1039599035 8:38818289-38818311 CTACTTCCTAATCCTAATCCAGG - Intronic
1040281682 8:46054974-46054996 CTGCTTCCTAGTTTTTATTTAGG - Intergenic
1040282775 8:46074134-46074156 CTTCTTCCTAGTTTTTATTCAGG - Intergenic
1040360562 8:46660415-46660437 CTGCTTCTTAACTAGAATTCTGG + Intergenic
1041528177 8:58832605-58832627 CTGCCTCATAAGTATAATTCTGG + Intronic
1044419327 8:91974772-91974794 CAGCTTTCTAATTCTTAATCTGG + Intronic
1046496462 8:115020582-115020604 CTGGTTCCTAATTTTTATACAGG + Intergenic
1046844003 8:118895174-118895196 CTGCTATCTAACTTTAATTCTGG - Intergenic
1049100896 8:140578200-140578222 TTGCTGCCTAATTCTAACACGGG + Intronic
1052411980 9:28133358-28133380 CTGCTTCATATTTATAATTATGG + Intronic
1055500683 9:76899770-76899792 CTGCTTCTTGAGTCTAAGTCAGG - Intronic
1057739867 9:97701630-97701652 CTGCTTCATAATCCCAATTGGGG - Intergenic
1058501632 9:105625042-105625064 CTGTTTGCTAATTCTAAATTAGG + Intronic
1060089656 9:120731741-120731763 CTGCCTCCTCGTTCTCATTCAGG - Intergenic
1061621887 9:131815977-131815999 CAGGTTCCTGATTCTAAATCTGG + Intergenic
1188410641 X:29868002-29868024 CTGCTTTCAAATTATCATTCAGG + Intronic
1188986492 X:36772926-36772948 CTGCTGCCAAATACTCATTCAGG + Intergenic
1190454655 X:50615921-50615943 AAGCTTCCTAATTCTATTACTGG + Intronic
1190979055 X:55439434-55439456 CTGCTTACTAATCCTTTTTCAGG - Intergenic
1192072676 X:67957822-67957844 CTGGTTCCTAGATGTAATTCAGG - Intergenic
1192881425 X:75288110-75288132 TTGCTTCCTAATTCAATTTTAGG - Intronic
1193367966 X:80657770-80657792 CTGCTTCCTACTTCTTATTTAGG - Intergenic
1196617838 X:117787653-117787675 CTACATCCTCATTCTACTTCTGG + Intergenic
1199192672 X:144989684-144989706 CTGCTTCCTAGCTGTTATTCTGG - Intergenic
1201779590 Y:17704611-17704633 CTTCTTTCTAATTTTTATTCAGG + Intergenic
1201821965 Y:18201381-18201403 CTTCTTTCTAATTTTTATTCAGG - Intergenic