ID: 917301304

View in Genome Browser
Species Human (GRCh38)
Location 1:173577201-173577223
Sequence CCTGCTGGAGACCATCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917301299_917301304 1 Left 917301299 1:173577177-173577199 CCCAAGAGTCGCAGTTTGCCAAG 0: 1
1: 0
2: 1
3: 6
4: 118
Right 917301304 1:173577201-173577223 CCTGCTGGAGACCATCACTGAGG 0: 1
1: 0
2: 0
3: 38
4: 215
917301297_917301304 28 Left 917301297 1:173577150-173577172 CCATTTTTAGCTAACAGGCAGAT 0: 1
1: 0
2: 1
3: 9
4: 186
Right 917301304 1:173577201-173577223 CCTGCTGGAGACCATCACTGAGG 0: 1
1: 0
2: 0
3: 38
4: 215
917301300_917301304 0 Left 917301300 1:173577178-173577200 CCAAGAGTCGCAGTTTGCCAAGT 0: 1
1: 0
2: 0
3: 8
4: 84
Right 917301304 1:173577201-173577223 CCTGCTGGAGACCATCACTGAGG 0: 1
1: 0
2: 0
3: 38
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917301304 Original CRISPR CCTGCTGGAGACCATCACTG AGG Intronic
900488210 1:2933499-2933521 TCTGCTGGAGACCAACACTCCGG - Intergenic
900582134 1:3414541-3414563 CCTGCTGGACAACAGCACAGAGG - Exonic
901756061 1:11442310-11442332 TCTGCTGGTGACATTCACTGTGG - Intergenic
902651393 1:17839922-17839944 CCTGTTGGAGTCCCTCGCTGCGG + Intergenic
903788959 1:25879800-25879822 CCTGCTTGATATCAGCACTGTGG - Intergenic
904171382 1:28593976-28593998 CCTGCTGGATAGCATCAGCGAGG - Exonic
906037848 1:42763741-42763763 CATGCTGGAGTCCATTGCTGTGG - Intronic
906060960 1:42948310-42948332 CCTGCTGCAGGCCAACCCTGGGG - Intronic
906842388 1:49153264-49153286 CTTGCTGAAGACTGTCACTGAGG + Intronic
907342980 1:53750154-53750176 GCTTCTGGAAACCACCACTGAGG - Intergenic
912384319 1:109263732-109263754 CCTGCTGCAGGCCATCACCAGGG + Exonic
915081424 1:153355251-153355273 CCTGCCGCACACCATCACTCAGG + Intergenic
916120284 1:161523474-161523496 CCAGCTGGAGACCAGGACTCAGG - Intronic
916747812 1:167697788-167697810 CCAGCTGGAGACCAGCAGTGAGG + Exonic
917301304 1:173577201-173577223 CCTGCTGGAGACCATCACTGAGG + Intronic
917528023 1:175806781-175806803 CCTGCTGGAGACCTTAGCTGAGG - Intergenic
917606288 1:176633626-176633648 TCTGATGGAGACTATCACTTTGG - Intronic
918204566 1:182297476-182297498 TATGCTGGCCACCATCACTGAGG + Intergenic
919625801 1:199909094-199909116 CAAGCTGGAGACCACCAGTGAGG + Intergenic
919839976 1:201601902-201601924 CCTCCTCGACACCACCACTGAGG - Intergenic
922468711 1:225862291-225862313 GCTGCTGGAGAGGATCACAGAGG - Exonic
922807413 1:228397549-228397571 CCAGCTGGAGCCCAACCCTGTGG + Intronic
922988798 1:229887229-229887251 ACTGCTGGCCACCCTCACTGAGG - Intergenic
923627359 1:235624988-235625010 CCTGCTGAGGACCCACACTGAGG + Intronic
1064345586 10:14530134-14530156 CCTGCAGGTGGCCATCACTGTGG - Intronic
1065890776 10:30119293-30119315 CCTGCTGGAGACACTAACTGAGG - Intergenic
1070351772 10:75599479-75599501 CATGCTGGAAACCATCAGTCAGG + Intronic
1070444758 10:76486380-76486402 CATTCTGGATACCTTCACTGCGG + Intronic
1070587988 10:77780690-77780712 CCTGCTGGCCACCACCACGGAGG - Intergenic
1070979701 10:80634313-80634335 TCTCCTGGAGAACATGACTGAGG + Intronic
1073187747 10:101626880-101626902 CCTGCTGGAGATCAGAGCTGTGG + Intronic
1073282062 10:102361732-102361754 GCTTATGGAGATCATCACTGTGG + Exonic
1073535677 10:104274903-104274925 CCACCTGGAGACCATGTCTGGGG + Exonic
1074110256 10:110417718-110417740 CCTGCTGGGGACCATCTCACGGG + Intergenic
1074764879 10:116693126-116693148 CCGGCTGGTAAGCATCACTGTGG - Intronic
1075639122 10:124051649-124051671 ATGGCTGCAGACCATCACTGTGG + Intronic
1076047417 10:127305609-127305631 GCTGCTGGAGACCAGCAGGGAGG + Intronic
1076873157 10:133203313-133203335 CCTGCTGGACACCATGAGTTTGG - Intronic
1077405610 11:2381223-2381245 ACTGCTGGACAGCCTCACTGGGG - Intronic
1079503723 11:21131471-21131493 CCTGCTGCAGATGATGACTGAGG - Intronic
1081661169 11:44889336-44889358 CCTGCTGGAGCCTATGGCTGGGG - Intronic
1081869303 11:46376124-46376146 CCTGCTGGAGTCTCTCAATGTGG - Exonic
1084457595 11:69277538-69277560 CCTTCTGGAGACCAGCCATGTGG - Intergenic
1085800578 11:79585613-79585635 CCTCCCTGAGCCCATCACTGTGG - Intergenic
1088115336 11:106305891-106305913 TCTGCTGGAGCCCATAAGTGAGG - Intergenic
1090999143 11:131893780-131893802 CATGATGGAGACCAACTCTGAGG - Intronic
1092012440 12:5125813-5125835 CCTGCTGGAGAGCCTCTCTCTGG + Intergenic
1096262787 12:50103529-50103551 CCTGCTGGAGGACAGAACTGTGG + Intergenic
1098114844 12:67164201-67164223 CCTCCTGGAGAGCAGAACTGGGG - Intergenic
1102038146 12:109783662-109783684 CCTGCTGGTGGCCATCGCAGCGG + Exonic
1102970614 12:117163131-117163153 GCTGCTGGAGTCCATCTCTTGGG - Intronic
1103048072 12:117754991-117755013 CCTGCTGGGAACCATCTCTGTGG - Intronic
1105708163 13:22981643-22981665 CCTGCTGGTAGCCAGCACTGGGG - Intergenic
1106228243 13:27801219-27801241 CCAGCTAGAGGCCATCTCTGGGG - Intergenic
1107787490 13:43970493-43970515 CCTGCTGGAGTCTCTCAATGTGG - Intergenic
1108453591 13:50590826-50590848 CCTGCTGTAGACAAGCAGTGTGG - Intronic
1108601244 13:51997008-51997030 CCTGCCAGAGGCCAGCACTGTGG + Intronic
1109970088 13:69756722-69756744 ACTGCTGGAGAACACCACAGAGG - Intronic
1110772056 13:79361010-79361032 CCTGCAGGAGACCATAGCTGTGG - Intronic
1111866214 13:93771925-93771947 CCTGCTGAAGATTAGCACTGTGG + Intronic
1113924659 13:113934836-113934858 GATTCTGGAGACCATAACTGGGG - Intergenic
1115310577 14:31974626-31974648 CCTGCTGGAGTCCACCACCCAGG - Intergenic
1118337449 14:64866149-64866171 CCTACTGGTGACCTTCACTATGG + Intronic
1118709495 14:68508070-68508092 CCTGCTGAAGACTATTTCTGAGG + Intronic
1119209183 14:72817147-72817169 CAAGCTGGAGAGCTTCACTGGGG - Intronic
1119445486 14:74659894-74659916 CTTGCTGGAGAACCTCGCTGTGG + Intronic
1119451283 14:74713035-74713057 CCGGGTGGAGACCAACTCTGGGG - Exonic
1119805984 14:77482652-77482674 CCTGCAGGTGACCATCAAGGTGG - Exonic
1120229913 14:81830555-81830577 CCAGCTGGACATCTTCACTGAGG + Intergenic
1120935557 14:89892303-89892325 CCTGCTGGATAGCATCAGTGAGG - Intronic
1121619105 14:95333844-95333866 CTGGCTGGAGAACATCACGGAGG - Intergenic
1123131182 14:105986809-105986831 CTTGCAGGAGACCTTCACTGAGG + Intergenic
1123133230 14:106005322-106005344 CTTGCAGGAAACCTTCACTGAGG + Intergenic
1123135628 14:106025372-106025394 CTTGCAGGAAACCTTCACTGAGG + Intergenic
1123145125 14:106122499-106122521 CTTGCAGGAGACCTTCACTGAGG + Intergenic
1123150229 14:106174568-106174590 CTGGCAGGAGACCTTCACTGAGG + Intergenic
1123151377 14:106185126-106185148 CTTGCAGGAGACCTTCACTGAGG + Intergenic
1123160837 14:106276773-106276795 CTTGCAGGAGACCTTCACTGAGG + Intergenic
1123184880 14:106507223-106507245 CTTGCAGGAAACCTTCACTGAGG + Intergenic
1123185334 14:106511342-106511364 CTTGCAGGAAACCTTCACTGAGG + Intergenic
1123196525 14:106622584-106622606 CTTGCAGGAGACCTTCACTGAGG + Intergenic
1123204999 14:106704073-106704095 CTTGCAGGAGACCTTCACTGAGG + Intergenic
1123206096 14:106714909-106714931 CTTGCAGGAGACCTTCACCGAGG + Intergenic
1123209998 14:106750514-106750536 CTTGCAGGAGACCTTCACTGAGG + Intergenic
1123211180 14:106762319-106762341 CTTGCAGGAGACCTTCACCGAGG + Intergenic
1123223099 14:106874808-106874830 CTTGCAGGAGACCTTCACTGAGG + Intergenic
1123398925 15:19964893-19964915 CTTGCAGGAGATCCTCACTGAGG + Intergenic
1123399780 15:19973009-19973031 CTTGCAGGAGACCTTCACTGAGG + Intergenic
1123581414 15:21718035-21718057 CTTGCAGGAGACCTTCACTGAGG + Intergenic
1123583254 15:21735735-21735757 CTTGCAGGAGACCTTCACTGAGG + Intergenic
1123585047 15:21752503-21752525 CTTGAAGGAGACCTTCACTGAGG + Intergenic
1123618063 15:22160658-22160680 CTTGCAGGAGACCTTCACTGAGG + Intergenic
1123619904 15:22178332-22178354 CTTGCAGGAGACCTTCACTGAGG + Intergenic
1123621694 15:22195110-22195132 CTTGAAGGAGACCTTCACTGAGG + Intergenic
1124258314 15:28164004-28164026 CCTCCTGGAGGGCAGCACTGGGG + Intronic
1125350810 15:38765722-38765744 CCTGCTGAACTACATCACTGAGG - Intergenic
1125512929 15:40302537-40302559 CCTGCTGAAGACACTCACGGTGG - Exonic
1126220878 15:46211340-46211362 CCATCTGGAGACCATCATTCTGG + Intergenic
1126334404 15:47570626-47570648 CCTGCTGGGGTGCAGCACTGGGG - Intronic
1126463324 15:48936960-48936982 CCAGCTGGAGGTCATCCCTGTGG + Intronic
1128802205 15:70504071-70504093 CCTGCTGGAGACCTTGCTTGGGG + Intergenic
1131193156 15:90333440-90333462 CCTGCTGGAGAGGGTCCCTGGGG - Intergenic
1132507874 16:321320-321342 CCTGCTGGTGACAACCACTATGG + Intronic
1132736212 16:1387407-1387429 CCTGCTTCAGACCCTCAGTGTGG + Intronic
1132832008 16:1933035-1933057 CCTGCTGGGGGCCAGAACTGAGG - Intergenic
1133916284 16:10112540-10112562 CCTGCTGGCCACCACCACGGAGG + Intronic
1134273189 16:12753222-12753244 ACTGCAGGACAGCATCACTGGGG - Intronic
1135283458 16:21172869-21172891 CCTCCCTGAAACCATCACTGTGG + Intronic
1135530056 16:23245479-23245501 CCTTCTGGAGAGCATCCCAGTGG + Intergenic
1135593368 16:23721481-23721503 CCAGCAGGTGACAATCACTGGGG + Intergenic
1136485008 16:30565968-30565990 CCTGCTGCAGACCGATACTGAGG - Intergenic
1136679824 16:31952220-31952242 CTGGCAGGAGACCTTCACTGAGG - Intergenic
1136693977 16:32059271-32059293 CTTGCAGGAGACCTTCACTGAGG - Intergenic
1136794469 16:33002520-33002542 CTGGCAGGAGACCTTCACTGAGG - Intergenic
1136890237 16:33965881-33965903 CTGGCAGGAGACCTTCACTGAGG + Intergenic
1137704760 16:50526869-50526891 CCTGCTGGAAGCCCTCAGTGAGG - Intergenic
1138700417 16:58856850-58856872 CCCGCTTGAGATCATCACTGTGG - Intergenic
1139373762 16:66484281-66484303 ATGGCTGGACACCATCACTGTGG - Intronic
1140959180 16:79896042-79896064 CCTGTTGGAGTCACTCACTGTGG - Intergenic
1203082794 16_KI270728v1_random:1157733-1157755 CTGGCAGGAGACCTTCACTGAGG - Intergenic
1203096733 16_KI270728v1_random:1264187-1264209 CTGGCAGGAGACCTTCACTGAGG - Intergenic
1143204192 17:5131481-5131503 CCTGCTGGACAACAGCCCTGAGG - Intronic
1144778492 17:17796502-17796524 GCTGCTGGAGACCTTGAATGTGG - Exonic
1144875264 17:18394172-18394194 CCTGCTGGACAGCAGCCCTGAGG - Intergenic
1145156960 17:20550249-20550271 CCTGCTGGACAGCAGCCCTGAGG + Intergenic
1146159888 17:30554154-30554176 CCTGCTGGACAACATCCCTGAGG - Intergenic
1146730185 17:35186433-35186455 GCTGCTGGAGATCCTGACTGTGG + Exonic
1146844482 17:36174336-36174358 CCTGCTGGACAACAGCCCTGAGG + Intronic
1146856786 17:36262271-36262293 CCTGCTGGACAACAGCCCTGAGG + Intronic
1146863831 17:36326104-36326126 CCTGCTGGACAACAGCCCTGAGG - Intronic
1146872697 17:36386181-36386203 CCTGCTGGACAACAGCCCTGAGG + Intronic
1146880055 17:36437267-36437289 CCTGCTGGACAACAGCCCTGAGG + Intronic
1147075581 17:37986806-37986828 CCTGCTGGACAACAGCCCTGAGG + Intronic
1147078222 17:38006253-38006275 CCTGCTGGACAACAGCCCTGAGG - Intronic
1147087106 17:38066352-38066374 CCTGCTGGACAACAGCCCTGAGG + Intronic
1147094160 17:38130188-38130210 CCTGCTGGACAACAGCCCTGAGG - Intergenic
1149847626 17:60016781-60016803 CCTGCTGGACAACAGCCCTGAGG + Intergenic
1150085983 17:62273398-62273420 CCTGCTGGACAACAGCCCTGAGG + Intronic
1151764477 17:76125073-76125095 CCAGGTGGAGACCAGGACTGGGG + Intergenic
1151943616 17:77307389-77307411 CCTGCTGGAGATGATCCTTGTGG + Intronic
1152627898 17:81396619-81396641 CCTGCCGGAGACCAGGACTCTGG - Intronic
1152809711 17:82375670-82375692 CCTCCTGGAGACCCTCAGGGAGG - Intergenic
1157565511 18:48676659-48676681 CCTTCTGGGGACCCTCAATGGGG - Intronic
1158938628 18:62386679-62386701 CCAGCTGAAGAGCATGACTGTGG + Exonic
1162033918 19:7929189-7929211 CCTGCCCGAGTCCATCCCTGTGG - Intronic
1163148918 19:15399831-15399853 CCTGCTGGCGCTCATCACTCAGG + Intronic
1164678212 19:30117321-30117343 CCTGCAGGAGGCCATTCCTGGGG - Intergenic
1166141380 19:40807149-40807171 CCTGCTGCAGATCTTCCCTGAGG + Exonic
1166361484 19:42254554-42254576 CCTGCTGGTGACCTTCACGGCGG - Intronic
1167649489 19:50721596-50721618 CCTGCTGGAGGTCACCAGTGTGG - Intergenic
925546403 2:5021643-5021665 CCAGCTGGAGACCAGCAGTGTGG + Intergenic
925818272 2:7774490-7774512 TGTGCTGGAGACCATGGCTGGGG - Intergenic
927151337 2:20198215-20198237 CCTGCTGAGGACCTGCACTGGGG + Intergenic
927874764 2:26648014-26648036 CCGTCTGGAGACCCTCACTCAGG - Intergenic
928115642 2:28543560-28543582 CCTGCTTGAGTCAAGCACTGGGG + Intronic
928951095 2:36813578-36813600 CATGCTGGGGACCATCTCTCTGG + Intronic
929368570 2:41192649-41192671 CCTGCTGGAATCAATCCCTGTGG + Intergenic
929509346 2:42554760-42554782 CCTGCTGCACACAAACACTGGGG - Intronic
930057486 2:47263317-47263339 CCTGCTGGACCACATCACCGAGG + Intergenic
930640852 2:53853354-53853376 TCTGCTGGACATCAACACTGTGG - Exonic
932527630 2:72488356-72488378 GCTACTGGATACTATCACTGAGG - Intronic
932661391 2:73656107-73656129 ACTTCTGGAGACCAAGACTGGGG - Intergenic
936044450 2:109175539-109175561 CCTGAATGAGACCAGCACTGTGG + Intronic
936800998 2:116265773-116265795 TCTACTGTAGACCATCTCTGTGG + Intergenic
937094171 2:119224696-119224718 ACTTCTGGAGCCCATCTCTGAGG - Intronic
937315871 2:120931856-120931878 CATGCTGCTGCCCATCACTGGGG - Intronic
937399566 2:121570264-121570286 ATTGCTGGAGACTATCACTAGGG + Intronic
938144728 2:128823902-128823924 CCTGCTGGACTCCATCAGGGTGG - Intergenic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
946929187 2:224655585-224655607 CGTGCAGGAGCCCATGACTGGGG - Intergenic
1170602075 20:17848876-17848898 CCTGTTTGAGACCATCCCGGAGG - Intergenic
1175371842 20:58497432-58497454 CCTGCTGGAGGCCATGAGTCTGG + Intronic
1176745603 21:10649627-10649649 CTTGCAGGAGACCTTCACTGAGG + Intergenic
1179062908 21:37996044-37996066 CCTGCTGAAGTCCAGCAGTGTGG - Intronic
1180787865 22:18557053-18557075 CCTTCTGGAGGCCATGACTCTGG + Intergenic
1181015387 22:20065784-20065806 CCAGCTGGAGACCATGCCTCTGG + Exonic
1181233871 22:21438253-21438275 CCTTCTGGAGGCCATGACTCTGG - Intronic
1181244776 22:21496578-21496600 CCTTCTGGAGGCCATGACTCTGG + Intergenic
1185002650 22:48255559-48255581 GCTTCTGGACACCATCACTCAGG - Intergenic
951391055 3:22104185-22104207 CCTGCTGGAATCCATCATGGAGG - Intronic
951526618 3:23659080-23659102 CCTGCTGGGCACCAGCACTGGGG - Intergenic
951620335 3:24594530-24594552 ACTGCTGGGGACCCTCACTCTGG + Intergenic
952327200 3:32332281-32332303 CCTGCTGCAGACCTGCAGTGGGG + Intronic
952423728 3:33153655-33153677 TCTGCTGGAGACAACCACAGTGG - Exonic
952638081 3:35556032-35556054 CCTGCTGGGGAACATCAGTTAGG + Intergenic
954421275 3:50420289-50420311 CCGGCTGGGGTCCATCAATGTGG + Intronic
956767320 3:72494570-72494592 CTTGTTGGGGACCATCACGGAGG + Intergenic
961265996 3:125643283-125643305 CCTGGTGGAGACAAATACTGAGG + Intergenic
961728006 3:128945477-128945499 CGTGCTGGTGGCCATCTCTGGGG + Exonic
961925384 3:130473956-130473978 ACTGCTTGAGACCATCATTGTGG - Intronic
967887272 3:194341784-194341806 CCAGCTGGAGACTGTCGCTGAGG - Exonic
968650481 4:1758428-1758450 CCTGCCAGAAACCATCCCTGGGG + Intergenic
969321770 4:6417020-6417042 CCTGCTGGGGTCCAGCACTGGGG + Intronic
971989650 4:33875716-33875738 ACTGCTGGAGACCATCATTTAGG + Intergenic
977185012 4:93925767-93925789 CCTGTTGGAGACCATCAAGGTGG + Intergenic
978479552 4:109173800-109173822 AATGCTTGAGACCATCAGTGAGG + Intronic
978558547 4:110007082-110007104 GCTGCAGGAGATCATCAATGAGG + Intronic
980165229 4:129218079-129218101 CCTGCTAGAGACCATAAAAGAGG - Intergenic
980686199 4:136232830-136232852 ACTGCTGTAGAAAATCACTGGGG + Intergenic
984727172 4:183032684-183032706 CCTGATGGAGACCATGACCTGGG + Intergenic
985257040 4:188080661-188080683 CCAGCTGGAGCCTAGCACTGCGG + Intergenic
985678600 5:1244686-1244708 CCTGCTGCTGACCATCTTTGTGG + Exonic
986054694 5:4124690-4124712 CCTGCTGGTGACCCCCTCTGGGG - Intergenic
991430218 5:66536842-66536864 CCAGCCTGAGACCATCACTGAGG + Intergenic
997463741 5:134072757-134072779 GTTGGAGGAGACCATCACTGGGG - Intergenic
999950314 5:156642345-156642367 CCTGCTTAAAACCTTCACTGTGG + Intronic
1000335023 5:160235691-160235713 CCTGCTGGAGAGCTTCAGGGAGG - Intronic
1001706163 5:173742432-173742454 CATGCTCAAGACCATCACTCAGG + Intergenic
1002417143 5:179126535-179126557 CCTGCTGGAGAAAATCACCCGGG - Intronic
1002428370 5:179188868-179188890 CCTGCTGGAGTGCCACACTGAGG - Intronic
1004337551 6:14777978-14778000 CTTGCTGGAGAAAATAACTGGGG + Intergenic
1004732000 6:18367414-18367436 CCTGCTGGCTGCCATCACGGAGG - Intergenic
1006181277 6:32154756-32154778 CCTGCTGGAATACATCAATGAGG + Exonic
1011191932 6:84738537-84738559 CATTCTGGCGACCATCACTACGG - Exonic
1012586726 6:100932660-100932682 GCTGATTAAGACCATCACTGGGG + Intergenic
1013084058 6:106840662-106840684 TCTGCTGAAGGCCATCCCTGTGG + Intergenic
1013839412 6:114372468-114372490 CAGCCTGGAGACCATCACTGTGG - Intergenic
1017948348 6:159115165-159115187 GCTGCTGGAAACCAGCTCTGAGG + Intergenic
1020195117 7:6031846-6031868 CCACATGGAGATCATCACTGTGG - Intronic
1020311424 7:6871526-6871548 CCAGCTGGAGACCTTCAAAGGGG + Intergenic
1022124766 7:27345156-27345178 GCAGCTGGAGCCCAGCACTGAGG - Intergenic
1022627074 7:32048148-32048170 CTTGCTTGAGACCTTCTCTGGGG - Intronic
1029424248 7:100486564-100486586 CCTGCAGGGGAGCATCCCTGGGG - Intronic
1031726152 7:125242042-125242064 CCTTATGAAAACCATCACTGTGG + Intergenic
1032657133 7:133943165-133943187 AGTGCTGTAGATCATCACTGAGG + Intronic
1034874502 7:154713416-154713438 CCTCCTGGAGAACCTCACTAGGG - Intronic
1035453854 7:158996702-158996724 CCTGCTGGAGAATTTCACTGAGG + Intergenic
1035983085 8:4394895-4394917 CCTGCTGTAGAGGAACACTGTGG - Intronic
1036177296 8:6550861-6550883 CACGCTGCTGACCATCACTGTGG - Intronic
1036575036 8:10019576-10019598 ACTTTTGGAGACCATCTCTGTGG + Intergenic
1036575735 8:10026318-10026340 CCTGCTTGGGAGCTTCACTGGGG - Intergenic
1036621872 8:10429589-10429611 CCTTCAGGAGAACAGCACTGAGG + Intergenic
1038403584 8:27305358-27305380 ACTGCTGGAGGCCATCACTCAGG + Intronic
1041005699 8:53495291-53495313 CCTCCTGGAGGCCTCCACTGTGG + Intergenic
1041873409 8:62660885-62660907 CCAGCTGGGGACCATCCCTTGGG + Intronic
1043668580 8:82850420-82850442 CCTGCTGGAAACCAACACAAAGG - Intergenic
1044931846 8:97259200-97259222 CCCGCAAGAGACCGTCACTGGGG + Intergenic
1049258928 8:141628406-141628428 CATGCTGGACACAATCTCTGTGG + Intergenic
1049483485 8:142839267-142839289 CATGCAGGAGACCAAGACTGGGG - Intronic
1049653666 8:143788454-143788476 CCTGCAGGACACAATCCCTGGGG - Intergenic
1050699173 9:8317942-8317964 CCTGCAGGAGACAATGAATGGGG + Exonic
1053036039 9:34827386-34827408 CATCCTGGAGACCATCCATGGGG + Intergenic
1058439069 9:104991115-104991137 TCTTCTGAAAACCATCACTGAGG + Intergenic
1061660905 9:132129766-132129788 CCTGCTGGGGACCATCACGTGGG + Intergenic
1062092184 9:134684131-134684153 CCTGCTGGAGAGCATCTCTCAGG - Intronic
1062119950 9:134829150-134829172 ACTGCTGGAAACGCTCACTGAGG - Intronic
1062651940 9:137582356-137582378 TCTGCTGGAGATGAACACTGAGG + Exonic
1186750759 X:12619484-12619506 CCTGGTGGAGCCCAAGACTGAGG + Intronic
1187458596 X:19465400-19465422 GCAGCTGGAGACCATCCTTGTGG + Intronic
1188102041 X:26100715-26100737 CTTGCTAGAGAGCAACACTGAGG - Intergenic
1189361904 X:40359542-40359564 CCTGCTGGCCACCACCACGGAGG - Intergenic
1190321028 X:49179265-49179287 CTTCCCGGTGACCATCACTGGGG - Exonic
1196364671 X:114911265-114911287 GCTACTCGAGCCCATCACTGAGG + Intergenic
1197755730 X:129993042-129993064 CCTGCTGAAGACCAAGATTGAGG + Intronic