ID: 917301341

View in Genome Browser
Species Human (GRCh38)
Location 1:173577621-173577643
Sequence ACGGGGCCACTAATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917301341_917301344 -9 Left 917301341 1:173577621-173577643 CCTTCCTCCATTAGTGGCCCCGT 0: 1
1: 0
2: 0
3: 4
4: 60
Right 917301344 1:173577635-173577657 TGGCCCCGTAACTATAAAATAGG 0: 1
1: 0
2: 0
3: 2
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917301341 Original CRISPR ACGGGGCCACTAATGGAGGA AGG (reversed) Intronic
900760869 1:4469326-4469348 CCAGGGCCAGTAATGGACGATGG - Intergenic
903708776 1:25306493-25306515 CCGGGGCCACCAAAGGGGGATGG - Intronic
914796705 1:150926130-150926152 ATGGGGCCACTAGTCGAGGGTGG + Intergenic
917301341 1:173577621-173577643 ACGGGGCCACTAATGGAGGAAGG - Intronic
917966969 1:180185053-180185075 ATGGGGCCACTTCTGGAGGCAGG + Intronic
920290954 1:204922945-204922967 ATGGGGCCACTGTGGGAGGATGG - Intronic
1065298225 10:24296920-24296942 ACGTGGCAACTACAGGAGGATGG + Intronic
1071373858 10:84982659-84982681 AGGGGGCCATTAAAGGAGGAAGG - Intergenic
1076863844 10:133157863-133157885 CCTGGGCCCCTCATGGAGGAGGG + Intergenic
1077089406 11:771633-771655 ACACGGCCACTACAGGAGGACGG + Intronic
1087989089 11:104725378-104725400 ATATGGTCACTAATGGAGGAAGG + Intergenic
1088979856 11:114852335-114852357 ACTGGTCCACTGCTGGAGGAAGG + Intergenic
1092531259 12:9347544-9347566 GCGGGGCCAGAAAAGGAGGAGGG - Intergenic
1095624987 12:44304143-44304165 ACGTGGCCACTGCTGGGGGATGG - Intronic
1100689844 12:97028101-97028123 ACTAGGCCACTATTGGAGCAAGG + Intergenic
1117504558 14:56389162-56389184 ACATGGCCACTGCTGGAGGATGG + Intergenic
1119170442 14:72531134-72531156 ACCAGGCCACTATTGGAGGCTGG + Intronic
1120476910 14:84999790-84999812 CAGGGCCCACTAATGGTGGAAGG - Intergenic
1129867139 15:78917862-78917884 ACGGGGCCTGTCATGGAGTAGGG + Intergenic
1134196967 16:12166684-12166706 ACGGGGCCTCTAAAGGAGGGTGG - Intronic
1137931128 16:52588728-52588750 ATGGGGCCAGTAATGGGGGTGGG + Intergenic
1139939985 16:70598245-70598267 AAGAGGTCGCTAATGGAGGATGG - Intronic
1143477498 17:7211215-7211237 ACAGGGCAACTAAAGCAGGACGG + Intronic
1143503742 17:7352853-7352875 ACGGGGCCCCCAAAGGAGGGGGG - Exonic
1143882767 17:10042443-10042465 AGGGGGCCACGTATGGAGGAAGG - Intronic
1150898531 17:69241527-69241549 AGGGGGACACTAGTGGAAGATGG - Intronic
1151953574 17:77369364-77369386 ACTGGCACACTACTGGAGGAGGG + Intronic
1155612001 18:27676379-27676401 AAGAGGGCAGTAATGGAGGAAGG - Intergenic
1156868974 18:41922278-41922300 ACTGTTCCACTAATGGAAGAAGG - Intergenic
1157282108 18:46352951-46352973 ACAGTGCCACTAATGCAAGAAGG - Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1166410801 19:42554438-42554460 CCTGGGCCTCTCATGGAGGAGGG + Intronic
1167418440 19:49389417-49389439 ACGGGGACACTGAAGCAGGATGG - Intronic
939173078 2:138718303-138718325 ATGGGGCCACTTATAAAGGAAGG + Intronic
944491010 2:200257888-200257910 ACTGGGCCAGTAATGAAAGAAGG - Intergenic
944550139 2:200838264-200838286 ATGTGGCCACTACTGGGGGATGG - Intergenic
947793941 2:232882706-232882728 TCGGGGCCACGACGGGAGGAGGG + Intronic
948667661 2:239546398-239546420 ACAGGGCCACACTTGGAGGAAGG - Intergenic
1180074049 21:45453767-45453789 TCGGGGCCACACTTGGAGGATGG - Intronic
1181006142 22:20014621-20014643 ACAGGGCCAGGAATGGAGGGTGG - Intronic
1185061337 22:48608471-48608493 ACGTGGCCCCAAGTGGAGGACGG - Intronic
952807636 3:37371869-37371891 CCGGGGCCAGTTATGGGGGAGGG - Intergenic
965604476 3:170485010-170485032 AAGGGCCCACTCCTGGAGGAAGG + Intronic
966631311 3:182078388-182078410 TTGGGGCCACTTATGCAGGATGG + Intergenic
967677346 3:192316404-192316426 ATGCAGCCACTAATGGGGGATGG - Intronic
968983179 4:3861565-3861587 ACGTAGCCAGTGATGGAGGACGG + Intergenic
972926347 4:44013827-44013849 ATGGGGCCACAAACTGAGGATGG + Intergenic
987278720 5:16389979-16390001 AGGCTGCCACTCATGGAGGATGG - Intergenic
991266466 5:64725575-64725597 TCGGAGTCACTAAAGGAGGAAGG - Intronic
1001803347 5:174562346-174562368 AGCATGCCACTAATGGAGGAAGG - Intergenic
1003490916 6:6620717-6620739 CCTAGGCCACTAATGGAGGGTGG + Intronic
1010744350 6:79544012-79544034 TGGGGGCCACTTATGGAAGATGG - Intergenic
1030222326 7:107110053-107110075 ATGCGGCCACTGCTGGAGGATGG - Intronic
1035246776 7:157567648-157567670 ACTGGGCCAGTGATGGAGAATGG + Intronic
1036384257 8:8264637-8264659 ACGGGGGCACTAAGGAAGAAAGG - Intergenic
1037691766 8:21186656-21186678 AAGGAGCCCCTAAGGGAGGAAGG + Intergenic
1037934911 8:22909091-22909113 CTGGGGCCACCAATGCAGGAAGG - Intronic
1038242375 8:25821804-25821826 AGGAGGCCACTGAGGGAGGATGG + Intergenic
1038832165 8:31073738-31073760 GGAGGGCCACTAATGAAGGAGGG + Intronic
1041746253 8:61211922-61211944 AAGGGGCCACAAGTGAAGGAAGG + Intronic
1050285757 9:4100229-4100251 GCGGGGCCAATTATGGTGGAAGG - Intronic
1056429693 9:86514943-86514965 AGGGGGTCACTGATGGAGAAAGG - Intergenic
1062339259 9:136086703-136086725 ACGGGGCCACTGGTCGGGGAGGG - Intronic
1186398903 X:9238495-9238517 ACTGGGCCACAACTAGAGGAGGG + Intergenic
1189419700 X:40845916-40845938 AGGGGGCAACTACTGGAGAAGGG - Intergenic