ID: 917302469

View in Genome Browser
Species Human (GRCh38)
Location 1:173590755-173590777
Sequence CAGTGGGTATGCTGGCCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917302463_917302469 14 Left 917302463 1:173590718-173590740 CCACTAAGTGACTAACGGGCAGG 0: 1
1: 2
2: 12
3: 23
4: 56
Right 917302469 1:173590755-173590777 CAGTGGGTATGCTGGCCAAAGGG 0: 1
1: 0
2: 1
3: 21
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917302469 Original CRISPR CAGTGGGTATGCTGGCCAAA GGG Intronic
902159904 1:14521353-14521375 AATTGGGTCTGCTGTCCAAATGG + Intergenic
906224215 1:44107615-44107637 GAGTGGAAATGCTGGACAAAGGG - Intergenic
906758104 1:48341419-48341441 GCGTGGGTATGCTGGACAAAAGG - Intronic
911507810 1:98775300-98775322 CAGTGGACATGCTGGACAAAGGG + Intergenic
911669691 1:100593697-100593719 CAGTGGTGATGGTGGCCACAGGG - Intergenic
912268879 1:108189438-108189460 GTGTGGATATGCTGGACAAAAGG - Intronic
912588307 1:110787606-110787628 CAGTAGCTATGCAGGCCACAGGG - Intergenic
912659662 1:111516231-111516253 GAGTGGGAATGCGAGCCAAAAGG + Intronic
917302469 1:173590755-173590777 CAGTGGGTATGCTGGCCAAAGGG + Intronic
920091920 1:203460460-203460482 GTGTGGGTATGCTGGACAAAGGG + Intergenic
921576464 1:216841009-216841031 CAGTAGGTTTGCTGGACAAAGGG + Intronic
922553224 1:226512631-226512653 CAGTGGGAAAGCTAGCCACAGGG + Intergenic
923167117 1:231376302-231376324 GTGTGGATATGCTGGACAAAGGG - Intronic
1066024064 10:31335227-31335249 GTGTGGATATGCTGGACAAAGGG - Intronic
1069816763 10:71201380-71201402 GGATGGGTATGCTGGACAAATGG - Intergenic
1072019696 10:91386029-91386051 GGGTGGATATGCTGGACAAAGGG + Intergenic
1072108614 10:92297042-92297064 CATTGGGGATGGTGGTCAAAGGG - Intronic
1075339311 10:121632903-121632925 CAGTGGGTTTGCAGGCCAGGAGG + Intergenic
1076215495 10:128690082-128690104 CAGTGAGAATGGTTGCCAAACGG + Intergenic
1078543938 11:12232974-12232996 CCATGGATATGCTGGACAAAGGG - Intronic
1078707094 11:13754989-13755011 TAGTGGGATTGCTGGACAAATGG - Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1080844213 11:36012619-36012641 GTGTGTGTATGCTGGACAAAGGG + Intronic
1082904278 11:58289485-58289507 GTGTGGATATGCTGGACAAAGGG - Intergenic
1084148637 11:67277946-67277968 CAGGGGGTATCCTGGCCTGATGG + Intronic
1084733151 11:71087397-71087419 CAGGGGCTATTCTGGCAAAAGGG + Intronic
1087980197 11:104603206-104603228 AAGTGGATATACTGGACAAAGGG + Intergenic
1090681379 11:129061628-129061650 GTGTGGATATGCTGGACAAAGGG + Intronic
1091868872 12:3869961-3869983 GTGTGGATATGCTGGACAAAGGG + Intronic
1093801922 12:23383790-23383812 AAGTGGGCATGTTGGTCAAAGGG + Intergenic
1094351506 12:29530945-29530967 TAGTGGGGATGGTTGCCAAAGGG - Intronic
1097081150 12:56432026-56432048 CTGTGGATATGCTGGGCAGAGGG + Intronic
1097589329 12:61554510-61554532 CAGTGGGTAAGCGTACCAAATGG - Intergenic
1098555891 12:71818300-71818322 CTGTGGAGATACTGGCCAAAGGG + Intergenic
1098899517 12:76098688-76098710 GTGTGGATATGCTGGACAAAGGG + Intergenic
1100939173 12:99706699-99706721 CAGAGGGTATGTTTGCAAAATGG - Intronic
1101169466 12:102075039-102075061 CACTGGTTATCCTGGCAAAATGG - Exonic
1102557599 12:113737961-113737983 CAGTGTGTATGCTGGTCCCAAGG + Intergenic
1103171288 12:118822382-118822404 AGGTGGGGATGCTGGACAAAGGG + Intergenic
1104333013 12:127865496-127865518 TAGTGGGATTGCTGGTCAAATGG - Intergenic
1107383530 13:39882567-39882589 GAGTGGGTCTGCAGGGCAAAGGG + Intergenic
1107918449 13:45177498-45177520 GCATGGGTATGCTGGACAAAGGG - Intronic
1108094372 13:46885256-46885278 GTGTGGATATGCTGGACAAAGGG + Intronic
1109473959 13:62853127-62853149 GTGTGGATATGCTGGACAAAGGG + Intergenic
1109504278 13:63279409-63279431 GTGTGGATATGCTGGACAAAGGG - Intergenic
1113713959 13:112489355-112489377 CAGTGAGAACCCTGGCCAAAGGG - Intronic
1118099763 14:62583873-62583895 ACGTGGGTATACTGGACAAAGGG + Intergenic
1119411241 14:74432086-74432108 GAGTGGGTGTTCTGGCAAAAAGG - Intergenic
1121304240 14:92895904-92895926 GGGTGGATATGCTGGACAAAGGG - Intergenic
1121649558 14:95547746-95547768 CACTCTGTATGCTGGCCAGAGGG - Intergenic
1121804348 14:96803013-96803035 GTGTGGATATGCTGGACAAAGGG - Intronic
1125208981 15:37189230-37189252 GAGTGGATATGCTAGACAAAGGG + Intergenic
1126486767 15:49189736-49189758 GTGTGGATATGCTGGACAAAGGG + Intronic
1126895793 15:53255943-53255965 GAGTGGCTCTGCTGGCCACAGGG + Intergenic
1129799061 15:78399864-78399886 AAGTGGCTTTGCTGGGCAAAAGG - Intergenic
1131413548 15:92231816-92231838 GTGTGGATATGCTGGACAAAGGG - Intergenic
1132761099 16:1509039-1509061 CAGTGGCTCCACTGGCCAAAGGG - Intronic
1135925488 16:26690018-26690040 CAGTGGTTATATTGGCCCAAAGG - Intergenic
1138153021 16:54676882-54676904 CTGTGGCAGTGCTGGCCAAATGG + Intergenic
1138250051 16:55495069-55495091 CACAGGGTCTGCTGGCCAATGGG + Intronic
1140100259 16:71910237-71910259 GCGTGGATATGCTGGACAAAGGG - Intronic
1141844639 16:86599082-86599104 CAGCGGGTGTTCTGGGCAAAGGG - Intergenic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1142895862 17:2978427-2978449 GCGTGGGTATGCTGGACAAAGGG + Intronic
1146465209 17:33080802-33080824 GCGTGGATATGCTGGACAAAGGG + Intronic
1146829250 17:36053811-36053833 TAGTGGGATTGCTGGGCAAATGG - Intergenic
1148132889 17:45273109-45273131 CAGTGGGCAGGCTGACCAAGGGG - Intronic
1149177349 17:53889178-53889200 GTGTGGGTATGCTGGACAAAGGG + Intergenic
1149290278 17:55211705-55211727 CAGTGGGGAAGCTTGTCAAATGG - Intergenic
1149536079 17:57434514-57434536 CAAAGGGTTTGCTGGTCAAAGGG - Intronic
1149806659 17:59624194-59624216 TAGTGGGAATGCTGTCCGAATGG + Intronic
1153788319 18:8554794-8554816 CAGTGGGTGTCCTGGCCTGATGG - Intergenic
1155072888 18:22331693-22331715 CAGTGAGTATGTTTGCAAAAAGG + Intergenic
1157765305 18:50292152-50292174 AGGTGGATATGCTGGGCAAAGGG - Intergenic
1157887663 18:51384314-51384336 GAGTGGGTGTGGTGGCCAAGAGG + Intergenic
1163321444 19:16577214-16577236 CAGTGGGCATGCAGGCCCAGAGG - Exonic
925282925 2:2697326-2697348 CTTAGGGTATGCTGGCCAAAGGG - Intergenic
925570183 2:5302177-5302199 GCATGGGTATGCTGGACAAAGGG - Intergenic
927941097 2:27103260-27103282 CAATGGGTATGCTGGGTAGAAGG - Intronic
928299244 2:30110985-30111007 CAGTGGATATGCTGAACACAGGG + Intergenic
928942882 2:36744347-36744369 CAATGGGATTGCTGGTCAAATGG + Intronic
929038017 2:37713455-37713477 CTGTGGATATGCTGGACAAAGGG + Intronic
930772148 2:55139421-55139443 GACTGGGAATGCTGACCAAATGG - Intergenic
932449489 2:71800491-71800513 CAGTGGGAAGGCTGGGCAGATGG - Intergenic
933275625 2:80280789-80280811 ATGTGGATATGCTGGGCAAAAGG - Intronic
935799930 2:106685691-106685713 CAGTGGATCTGCTGGCCACATGG - Intergenic
936912224 2:117604811-117604833 CAGTAGGTCTCCTGGACAAATGG + Intergenic
938107601 2:128543962-128543984 CAGTGAGGATGCTGGCTACACGG + Intergenic
939354247 2:141080905-141080927 AGGTGGGTATGCTGGAGAAAGGG - Intronic
940599316 2:155837622-155837644 GTGTGGATATGCTGGACAAAGGG + Intergenic
940761456 2:157743120-157743142 CAGTTGGTATGCCAGACAAAAGG - Intronic
940765799 2:157788406-157788428 GTGTGGGTACGCTGGACAAATGG - Intronic
940943803 2:159593676-159593698 GAGTAGATATGCTGGACAAAGGG - Intronic
941511107 2:166411316-166411338 GAGTGGATGTGCTGGACAAAGGG - Intronic
941831491 2:169965653-169965675 AAATGGATATGCTGGACAAAGGG + Intronic
942174367 2:173317535-173317557 GCGTGGATATGCTGGACAAAAGG - Intergenic
942909163 2:181220880-181220902 AGGTGGGGATGTTGGCCAAAGGG - Intergenic
948722607 2:239911054-239911076 TAGTGGGTCTGCTGGGCAGAGGG + Intronic
1173861168 20:46284630-46284652 CAGTGAGTATGCTGGTCCAGTGG + Intronic
1178327591 21:31658263-31658285 CAGTGCAAATGCTGGCCAAAGGG - Intergenic
1179787340 21:43737411-43737433 CACTGGGAATACTGGCCACAAGG - Intronic
1179831605 21:44000525-44000547 CAGTGGGTTTTCTGATCAAAGGG - Intergenic
1180244114 21:46534865-46534887 CTGTGGTTGTGCTGGCCAAGAGG + Intronic
1182170406 22:28222988-28223010 CATTAGGTATGCTGACAAAAAGG + Intronic
1182459643 22:30474681-30474703 CAGAGGGTATGCTCACCAATGGG - Intergenic
1182775681 22:32829510-32829532 CGGTGGGGATGCTGGCTAGATGG - Intronic
1182937003 22:34233508-34233530 TAGTGGGATTGCTGGTCAAATGG + Intergenic
949199758 3:1361402-1361424 CAGTAGGAATGCTGAACAAAAGG - Intronic
949926273 3:9044367-9044389 GAGTGGATATGCAGGACAAAGGG + Intronic
950936129 3:16841314-16841336 TCGTGGGTATTCTGGACAAAAGG + Intronic
953708026 3:45245778-45245800 CAGAGTGTCTGCTGGCCACATGG + Intergenic
953724631 3:45387379-45387401 GCGTGGATATGCTGGACAAAGGG - Intergenic
953846927 3:46434984-46435006 CAGTGGGGAACATGGCCAAATGG + Intergenic
954820825 3:53325940-53325962 GAGTGGGTTTTTTGGCCAAAAGG - Intronic
955641895 3:61094806-61094828 CAGTGCATATGCTGGACAAAGGG + Intronic
957835607 3:85585145-85585167 GAGTGGATATGCTGGACCAAGGG - Intronic
959268137 3:104169755-104169777 CTGTGGGGATGCTGCACAAAAGG + Intergenic
961971547 3:130973560-130973582 GTGTGGATATGCTGGACAAAGGG + Intronic
964780439 3:160331274-160331296 GAGTGGATATGCTGGACAAAGGG + Intronic
965573729 3:170197020-170197042 AGGTGGATATGCTGGACAAAGGG - Intergenic
966156324 3:176920521-176920543 CAGTGAATACGCTGGACAAAGGG - Intergenic
967445240 3:189558026-189558048 CAGTGAATATGCTGGACAAAGGG + Intergenic
967517395 3:190386519-190386541 ATGTGGAAATGCTGGCCAAAGGG + Intronic
967714506 3:192747060-192747082 GCATGGATATGCTGGCCAAAGGG - Intronic
969602607 4:8185823-8185845 GAGTGGGGTTGCTGGGCAAAGGG + Intronic
970203624 4:13633813-13633835 GAGTGGATATGCTGGACAAAGGG + Intergenic
973325274 4:48854271-48854293 GTGTGGATATGCTGGACAAAGGG + Intronic
975234392 4:71974889-71974911 GAGTGGAGATGCTGGTCAAAGGG + Intergenic
976584589 4:86780936-86780958 CAGTGGTTATGTGGGACAAACGG + Intronic
977142828 4:93396445-93396467 GTGTGGATATGCTGGACAAAGGG + Intronic
979200736 4:117975007-117975029 ATGTGGATATGCTGGACAAAAGG + Intergenic
981507578 4:145519771-145519793 CAGAGGAAATGCTGGTCAAAGGG - Intronic
984049982 4:174853877-174853899 GTGTGGGTATGCTGGACAAAAGG + Intronic
984358378 4:178695081-178695103 GAGTGGAGATGCTGGACAAAGGG - Intergenic
987598163 5:20028686-20028708 GCGTGGATAAGCTGGCCAAAGGG + Intronic
987607562 5:20157068-20157090 GCATGGGTATGCTGGACAAAGGG + Intronic
990902078 5:60762630-60762652 CAGTGTGTATCCTGGCCTCATGG + Intronic
991937428 5:71815902-71815924 CAGTAGAAATGCTGGCCAAGGGG - Intergenic
993413723 5:87601156-87601178 CAGTGGGTATGCTGAGCCATGGG + Intergenic
993914386 5:93724984-93725006 GAGTGAATATGCTGGACAAAGGG + Intronic
995340881 5:111057833-111057855 GTGTGGGTATGGTGGACAAAGGG + Intergenic
995718961 5:115109470-115109492 GAGTGGAAATGCTGGACAAAGGG - Intergenic
996370043 5:122743677-122743699 CAGTTGGTATGCTGACCAGAAGG + Intergenic
996370200 5:122745223-122745245 CAGTTGGTATGTTGACCAGAAGG - Intergenic
997356278 5:133265100-133265122 CCCTGGGAATGCTGGCCATAGGG + Intronic
998576461 5:143323139-143323161 GTGTGGATATGCTGGACAAAGGG - Intronic
999238566 5:150114459-150114481 CCGGGGGTATCCTGGGCAAAAGG - Exonic
999675553 5:153998199-153998221 CTGTGGATATGCTGGACAAAGGG - Intronic
1000016532 5:157282619-157282641 AAGTGGGATTGCTGGTCAAATGG + Intronic
1004718469 6:18242576-18242598 GTGTGGATATGCTGGACAAAGGG - Intronic
1004807387 6:19219075-19219097 TTGTGGATATGCTGGACAAAGGG - Intergenic
1004955198 6:20721582-20721604 TAGTGGGATTGCTGGACAAATGG + Intronic
1005683660 6:28231348-28231370 GTGTGGATATGCTGGACAAAAGG + Intronic
1006662562 6:35660208-35660230 AAGTATGTATGCTGACCAAAAGG - Intronic
1010698023 6:79002536-79002558 ATGTGGATATGCTGGACAAAGGG - Intronic
1010930492 6:81796079-81796101 CATTGGGGAAGCTGGGCAAAGGG + Intergenic
1014817775 6:125953835-125953857 CAGAGGGGCTGCTGGCCACAGGG + Intergenic
1016105377 6:140156381-140156403 GCGTGGATATGCTGGACAAAAGG - Intergenic
1016486098 6:144541376-144541398 CAGTGGGTATTCTGCAGAAAAGG + Intronic
1016858598 6:148696192-148696214 CAATGTGTCTGCTGCCCAAATGG + Intergenic
1017545269 6:155444341-155444363 TACTGGATATGCTGGACAAAGGG - Intronic
1019423561 7:962902-962924 CTGTGGCTCTGCTGCCCAAAGGG + Intronic
1020625319 7:10570837-10570859 GCGTGGATATGCTGGGCAAAGGG + Intergenic
1022205190 7:28157136-28157158 CAGAGTGTCTGCTGGGCAAATGG + Intronic
1022548350 7:31210188-31210210 GTGTGGATATGCTGGACAAAGGG + Intergenic
1023171839 7:37397536-37397558 CAGAGGTGATGCTGCCCAAAGGG - Intronic
1023678796 7:42661488-42661510 TTGTGGATATGCTGGACAAAGGG + Intergenic
1023924578 7:44657103-44657125 CACTGGGGAAGCTGGCCAAAGGG - Intronic
1024378777 7:48670082-48670104 CTGTGGATATGCTGGAGAAATGG + Intergenic
1027200120 7:76058868-76058890 GCATGGGTATGCTGGGCAAAGGG + Intronic
1028935705 7:96461873-96461895 CAGTGGGATTTCTGGCCATATGG + Intergenic
1031261756 7:119530047-119530069 AAGTGGGATTGCTGGACAAATGG - Intergenic
1032282012 7:130511470-130511492 CTGTGGGAATGCTGTACAAATGG + Intronic
1033013608 7:137648580-137648602 TAGTGGATATGCTGGACAGAGGG + Intronic
1034059490 7:148073472-148073494 GCGTGGATATGCTGGACAAATGG - Intronic
1036209047 8:6827249-6827271 CAGTGGGTTTGCTGGGCAGCAGG - Intronic
1036409856 8:8489372-8489394 CCGGGTGTATGCTGGGCAAAGGG - Intergenic
1038876059 8:31550918-31550940 CAGAGAGTATACTGGGCAAAAGG + Intergenic
1044951529 8:97440061-97440083 GCATGGGTATGCTGGACAAAGGG + Intergenic
1046300355 8:112278168-112278190 CAGTGAGTAGGGTGGCCCAAGGG + Intronic
1048583809 8:135754221-135754243 CCATGGATATGCTGGACAAAGGG - Intergenic
1048961366 8:139582139-139582161 CAGCGTGTGTGCTTGCCAAATGG + Intergenic
1049140935 8:140953495-140953517 TGGTGGATATGCTGGACAAAGGG + Intronic
1050529011 9:6571616-6571638 CAGTGGATATGCTGGACAAAGGG + Intronic
1052349239 9:27441541-27441563 GTGTGGGTATGCTGGACAAAGGG + Intronic
1053176526 9:35929346-35929368 CAGTGGTTATGCCAGCCAAAGGG + Intergenic
1053271383 9:36751977-36751999 CAGTGGGTTTCCAGCCCAAAGGG - Intergenic
1055004632 9:71491620-71491642 GCATGGGTATGCTGGACAAAGGG - Intergenic
1055184306 9:73432175-73432197 GCGTGGGTATGCTGGTTAAAGGG + Intergenic
1056596018 9:88008185-88008207 GGGTGGATATGCTGGACAAAGGG - Intergenic
1058476725 9:105342308-105342330 GTGTGGATATGCTGGACAAAGGG - Intronic
1059130524 9:111743460-111743482 GTGTGGATATGCTGGGCAAAGGG - Intronic
1059550625 9:115225388-115225410 CAGTGGTTTTCCTGGCCACATGG - Intronic
1060035739 9:120254219-120254241 GGGTGGGAAGGCTGGCCAAATGG + Intergenic
1187249271 X:17582286-17582308 AAGTTGAAATGCTGGCCAAAAGG + Intronic
1189482196 X:41400643-41400665 CAGTGGTTCTGCTTTCCAAATGG + Intergenic
1189577166 X:42366394-42366416 GAGTGGATAGGCTGGACAAAGGG + Intergenic
1193521961 X:82541458-82541480 CTGTGGGGAAGCTGGCCAAATGG + Intergenic
1197233114 X:124028344-124028366 GCGTGGATATGCTGGACAAAGGG + Intronic
1198293074 X:135257396-135257418 CAGTGGTGATGGTGGCCACAGGG + Intronic
1200048020 X:153412883-153412905 CAGAGGGTAACCTAGCCAAAAGG - Intergenic
1200115999 X:153769963-153769985 CAGTGGTCATGCTGCCCAGAGGG - Intronic
1201453604 Y:14143852-14143874 AAGAGAGTATGCTGGCAAAATGG + Intergenic