ID: 917302997

View in Genome Browser
Species Human (GRCh38)
Location 1:173598153-173598175
Sequence TATCTACAAGGGCAGTCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917302997 Original CRISPR TATCTACAAGGGCAGTCCTA AGG Intronic
900501520 1:3007753-3007775 CGTCTACTAGGGCAGTGCTAAGG + Intergenic
908063010 1:60372147-60372169 TTTCTACTAGGGCAGTGCCAAGG + Intergenic
908177017 1:61565880-61565902 ACTCTACTAGGGCAGTGCTAAGG - Intergenic
917302997 1:173598153-173598175 TATCTACAAGGGCAGTCCTAAGG + Intronic
921630036 1:217422376-217422398 AATGTAAAAGGCCAGTCCTACGG + Intergenic
1075745884 10:124727272-124727294 TATCTACAAGTGCCTTCCTGAGG - Intronic
1077993345 11:7431940-7431962 CCTCTACTAGGGCAGTGCTAAGG + Intronic
1078422999 11:11227706-11227728 CATCTATAAGGAGAGTCCTAGGG - Intergenic
1079147304 11:17864869-17864891 TTGCTACGAGAGCAGTCCTAAGG - Intronic
1080039136 11:27740432-27740454 TATCTCCTATGGAAGTCCTAAGG + Intergenic
1080042920 11:27777997-27778019 TATCTCCAAGCTAAGTCCTAGGG + Intergenic
1083067155 11:59936683-59936705 TATCTAGATGGACAGTGCTAAGG - Intergenic
1085662950 11:78386337-78386359 TGGCTACAAGGACAGACCTAGGG + Intronic
1094157814 12:27355933-27355955 TGTCTAAAAGGGAAGTCCTGAGG - Intronic
1100204215 12:92330731-92330753 TATATATAAGGTCAGTGCTATGG + Intergenic
1109003328 13:56835338-56835360 TCTCTACTAGGTCAGTCTTAAGG - Intergenic
1109091534 13:58052352-58052374 TCTCTACTAGGGCAGTGCAAAGG + Intergenic
1109546899 13:63843205-63843227 TATCTGCAATGGGGGTCCTAAGG - Intergenic
1113032845 13:106013865-106013887 TACCTACAAGTGAATTCCTAAGG + Intergenic
1114431602 14:22666290-22666312 ACTCTACAAGGGCAGTGCCAAGG - Intergenic
1114636873 14:24192535-24192557 TATCCAGAGGGGCAGACCTAAGG - Intronic
1114870530 14:26650526-26650548 TATATACAAGGGCACTCTTCGGG - Intergenic
1119189669 14:72672251-72672273 TTTATACAAGAGCAGTCCTGGGG - Intronic
1122196753 14:100093541-100093563 TATCTACAACTGCAGTACAAAGG - Intronic
1126438668 15:48663563-48663585 TATTTCCAAGGTCATTCCTAGGG + Intergenic
1126469376 15:48991491-48991513 TATGTACAAGAGCATTCCTGAGG + Exonic
1129582920 15:76831397-76831419 TGTCTACAAAAGCACTCCTATGG - Intronic
1131355244 15:91739841-91739863 TATCTACAAATGCAGTTCTAAGG - Intergenic
1131798149 15:96041687-96041709 CATCTACAAGGCAAGTACTATGG + Intergenic
1138632937 16:58313523-58313545 TTTCTCCAAGGGCAGTGATATGG - Intronic
1141660512 16:85438886-85438908 AATCTACCCGTGCAGTCCTAGGG + Intergenic
1144671022 17:17132634-17132656 TATATCCAAGGGCAGCCCAAGGG - Intronic
1144754448 17:17670665-17670687 CATCTTCAAGGGAAGTGCTATGG + Intergenic
1145251651 17:21300001-21300023 TATCGTCAAGGACAGGCCTAGGG - Intronic
1146551220 17:33781870-33781892 TATCTACAAGTGGAGTCAAAAGG - Intronic
1156772556 18:40747258-40747280 TATCTTTAAGAGCAGTCTTAAGG + Intergenic
1159947478 18:74455117-74455139 TATCTTCAATGGCAGCCATATGG - Intronic
927130880 2:20059384-20059406 TGTCCACAAGGGCAGTCAGAAGG - Intergenic
929081625 2:38127758-38127780 TATCTAGTAGGGCAGTGCAAAGG + Intergenic
942386734 2:175450771-175450793 CATCTACAGGGGCAGAGCTATGG + Intergenic
948302238 2:236916107-236916129 AAACTACAAGGGCAGTTCCAGGG - Intergenic
1170340802 20:15324960-15324982 TATGTAAAAGGGCATTCATAAGG + Intronic
1170703014 20:18720990-18721012 TATCTACATGGAAAGTCCAAAGG - Intronic
1172451135 20:35023981-35024003 TAGCAACAAGGTCAGTCCCAAGG + Intronic
1177368295 21:20167914-20167936 CTTCTTCAAGGGCAGTGCTATGG - Intergenic
953150849 3:40322978-40323000 TTTCTAAAAGGGCAGAGCTATGG + Intergenic
953243755 3:41172201-41172223 ATTCTACAAGGGCAGTAATAGGG - Intergenic
953972746 3:47359808-47359830 TCTCTACTAGGGCAGTGCCAAGG + Intergenic
960451335 3:117812560-117812582 TATAATCAAGGCCAGTCCTATGG + Intergenic
961382433 3:126504535-126504557 TTTCTACAAGGGAAGCCCAAAGG + Intronic
961708029 3:128804542-128804564 CATCAACAAGTACAGTCCTATGG - Intronic
966565885 3:181380716-181380738 TGTCAACCAGGGCAGTCCTTAGG - Intergenic
976164835 4:82243456-82243478 TATCTTCAAGTAAAGTCCTATGG - Intergenic
978408631 4:108405608-108405630 ACTCTACCAGGGCAGTGCTAAGG - Intergenic
981394371 4:144229788-144229810 TGTCTACAAGGGTACACCTAAGG - Intergenic
982824669 4:159987294-159987316 TATCTACAAGGGTAGAAGTAGGG + Intergenic
1002787681 6:416805-416827 TATCTAAAAGGGTATTCCAAAGG + Intergenic
1004755748 6:18608497-18608519 ACTCTACAAGGGCAGTGCCAAGG - Intergenic
1010452091 6:76014717-76014739 CATCTACAATGCCAGTCCCAGGG - Intronic
1010630468 6:78191864-78191886 CTTCTACTAGGGCAGTGCTAAGG - Intergenic
1015123313 6:129724490-129724512 TACCTACCAGGGCTGTTCTAAGG + Intergenic
1027586667 7:80066520-80066542 TCTCTACTAGGGCAGTGCCAAGG - Intergenic
1031283936 7:119841315-119841337 TCTCTACTAGGGCAGTCCCAGGG + Intergenic
1033781309 7:144672729-144672751 TATTTCCAAGGGCACTCCGATGG + Intronic
1034212148 7:149373231-149373253 CTTCTACTAGGGCAGTGCTAAGG - Intergenic
1035034202 7:155884705-155884727 TATCAAGAGGGGCTGTCCTAAGG + Intergenic
1036115601 8:5957447-5957469 TATCTACTAGGGGTGTCATATGG - Intergenic
1036282042 8:7408705-7408727 ACTCTACCAGGGCAGTGCTAAGG + Intergenic
1036339427 8:7902866-7902888 ACTCTACCAGGGCAGTGCTAAGG - Intergenic
1037364063 8:18103921-18103943 TTTCTACTAGGGCAGTGCCAAGG + Intergenic
1042266693 8:66915783-66915805 AATCTTCAAGGGCAGTCCTGGGG - Intronic
1044887714 8:96797552-96797574 TATCTCCAAGGGCATTCTGATGG + Intronic
1046460985 8:114535703-114535725 AGTTTACAAGGCCAGTCCTATGG - Intergenic
1048059977 8:130908936-130908958 TGACTCCAAGGGCAGTTCTAGGG + Intronic
1051876442 9:21799308-21799330 TATGTACCAGGCCAGTCCTAAGG - Intergenic
1055074619 9:72200683-72200705 TCTCTACAATGTCAGTCCTTTGG - Intronic
1057300249 9:93874398-93874420 TGTCTACTAGGGCAGTGCCAAGG - Intergenic
1062293327 9:135808166-135808188 TATTTTTAAGGGCAGTCCAAGGG - Intergenic
1188692805 X:33151027-33151049 TTTCAACAAGGGCAGTGATAAGG + Intronic
1191030856 X:55969031-55969053 TATCTAGAAGGTCTGTCCAATGG - Intergenic
1192705636 X:73526815-73526837 TCTCTACTAGGGCAGTGCTGAGG + Intergenic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic