ID: 917304449

View in Genome Browser
Species Human (GRCh38)
Location 1:173612614-173612636
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 4, 1: 88, 2: 17, 3: 35, 4: 370}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917304449_917304454 13 Left 917304449 1:173612614-173612636 CCTTCCACAGTCTCCCTCTGATG 0: 4
1: 88
2: 17
3: 35
4: 370
Right 917304454 1:173612650-173612672 GGACTGTACTGCTGCCATCTCGG 0: 791
1: 492
2: 154
3: 345
4: 7246
917304449_917304453 -8 Left 917304449 1:173612614-173612636 CCTTCCACAGTCTCCCTCTGATG 0: 4
1: 88
2: 17
3: 35
4: 370
Right 917304453 1:173612629-173612651 CTCTGATGCTGAGCTGAAGCTGG 0: 5
1: 103
2: 551
3: 691
4: 795

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917304449 Original CRISPR CATCAGAGGGAGACTGTGGA AGG (reversed) Intronic
901108485 1:6776377-6776399 CATCAGAGTGAGACTTGAGATGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901451682 1:9339931-9339953 CATCAGAAGGAAAAGGTGGAGGG - Intronic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902125830 1:14210143-14210165 CATGAGAGGGACACAGTGGGAGG + Intergenic
902922067 1:19672035-19672057 CATCCTTGGGAGATTGTGGAGGG + Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903581418 1:24373606-24373628 CTTCACAGGGAGTCTTTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904037569 1:27567046-27567068 AATCCTAGGGAGGCTGTGGAGGG + Intronic
904272190 1:29357343-29357365 CATCTGGGGGAGAATGTCGATGG - Intergenic
904677789 1:32208971-32208993 AGGCAGAGGGAGACTGTGGCAGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904992488 1:34604366-34604388 GAGGAGAGGGAGGCTGTGGAAGG + Intergenic
905493383 1:38362881-38362903 CATGAGAGGGACCCAGTGGAAGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907362399 1:53929161-53929183 CACCAGGGGGAGACTGGGGTGGG + Intronic
907964928 1:59319757-59319779 AGGCAGAGGGAGCCTGTGGAGGG + Intronic
908326426 1:63028262-63028284 CAGCACAGGGACAGTGTGGAGGG - Intergenic
908348182 1:63257542-63257564 CAGGAGAGAGAGACTGGGGAGGG - Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909183701 1:72457813-72457835 CATCAGAGAGAGAGAGAGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909679835 1:78279262-78279284 ATTCAGAGGGAAACTTTGGATGG + Intergenic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
910666162 1:89727827-89727849 CAGCAGTGGGAAACTGGGGAAGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913583559 1:120250766-120250788 CTACACAGTGAGACTGTGGAGGG - Intergenic
913624617 1:120647554-120647576 CTACACAGTGAGACTGTGGAGGG + Intergenic
914565547 1:148862602-148862624 CTACACAGTGAGACTGTGGAGGG - Intronic
914607278 1:149267650-149267672 CTACACAGTGAGACTGTGGAGGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914999727 1:152578390-152578412 CTTCAGAGAGAGAAGGTGGAGGG - Intronic
915342368 1:155183719-155183741 TACCAGAGGGAGACGCTGGAAGG - Intronic
916258723 1:162818906-162818928 CATGAGAGGGAAACTTTTGATGG + Intergenic
916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG + Intergenic
917009164 1:170451535-170451557 CATTAGTGGGAGGCTGAGGAAGG + Intergenic
917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
917596557 1:176535024-176535046 AACCAGAGGGAGACTGTAGAAGG + Intronic
919510193 1:198453538-198453560 CATTAGAGAGAGAATGTGGAAGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923390214 1:233507475-233507497 CAGCAGAGGAATTCTGTGGAAGG - Intergenic
923447048 1:234081508-234081530 CAGCAGTGGGTCACTGTGGATGG + Intronic
923904605 1:238369906-238369928 CATGAGAGGGACCCAGTGGAAGG - Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063946405 10:11180494-11180516 CATCAGGAGGAGACTGAGTACGG - Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064822115 10:19348979-19349001 CGACAGAGTGAGACTGTTGAAGG - Intronic
1067526587 10:47042995-47043017 CAGCAGAGGGAGACTGCTGTCGG + Intergenic
1067533654 10:47092612-47092634 CATCAGAGGGCCACTGAGGGAGG - Intergenic
1068396284 10:56466080-56466102 CAGCAGGTGGAGACTGTGGATGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069313548 10:67069323-67069345 CATGTAAGGGAGACTTTGGAAGG - Intronic
1069606692 10:69743373-69743395 CAGCAGAGGGCGACAGTGGGAGG + Intergenic
1070846337 10:79525109-79525131 CCTGTGTGGGAGACTGTGGAGGG - Intergenic
1070927460 10:80235197-80235219 CCTGTGTGGGAGACTGTGGAGGG + Intergenic
1072407913 10:95171657-95171679 CCTGTGTGGGAGACTGTGGAGGG - Intergenic
1072528732 10:96298186-96298208 CATGAGAGGGAGCCTGTCGGGGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1074897711 10:117791464-117791486 GGTCAGAGGGAGACTGAAGAAGG - Intergenic
1074984123 10:118642251-118642273 CCTCAGAGGGAGACAGTCCATGG + Intergenic
1075851549 10:125592312-125592334 CATCAAAGACAGACTGTGGCTGG - Intronic
1077434620 11:2532839-2532861 CAGCAGAGGGAGGCTGTGCAGGG + Intronic
1078161154 11:8840651-8840673 CTTGAGAGGGATGCTGTGGATGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078423745 11:11233042-11233064 AAATAGAGGGAGACTGAGGATGG + Intergenic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1082687748 11:56260614-56260636 CATGGGAGGGAGGCTGTGGGGGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083082031 11:60104026-60104048 AAACAGAAGTAGACTGTGGATGG - Intergenic
1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG + Intergenic
1083506143 11:63159343-63159365 CATGGGAGGGAGCCTGTGGGAGG + Intronic
1083965977 11:66043967-66043989 CATCATAGAAAGACTGTGGCTGG + Intronic
1084702737 11:70798148-70798170 CATCAGAGAGAGACTTTTGGGGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085906421 11:80769622-80769644 CATGGGAGGGACACTGTGGGAGG + Intergenic
1087202930 11:95364326-95364348 CTTCAGAGGGTGTCTGGGGAAGG + Intergenic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088184103 11:107144246-107144268 CAGCAGTGGGAGACTGTAGAGGG - Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1089526025 11:119097245-119097267 CACCAGAGTGAGACTGAAGATGG - Exonic
1089742773 11:120596456-120596478 CTTCAGAGAGAGACTGGAGAAGG + Intronic
1090210856 11:124920407-124920429 CCTCCGAGGGAGGCTGTGGGAGG + Exonic
1090490267 11:127154574-127154596 ATTCAGGGGCAGACTGTGGAAGG - Intergenic
1090570359 11:128038226-128038248 CAGCAGAGGGGCTCTGTGGAAGG + Intergenic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1092050724 12:5467994-5468016 CATCAGAGGGAAAATGTGGGGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092504975 12:9089448-9089470 AATCAAAGGGAGGCTGTGCATGG + Intronic
1092722422 12:11454930-11454952 TATCAGAGGGTGAAGGTGGAAGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095269847 12:40204811-40204833 CCTCAGAGGTACCCTGTGGACGG + Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096752355 12:53769139-53769161 AATCAGAAGCAGACTGTGGGGGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102136627 12:110581541-110581563 CATGAGAGGGAGACTTAGAAAGG - Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103767363 12:123290181-123290203 CGCCAGAGGGAGACTGAGCAAGG + Exonic
1104792255 12:131490990-131491012 CATCAGTGGGAGGCTGTGATTGG - Intergenic
1105469232 13:20677167-20677189 GAGGAGAGGGAGACTCTGGAGGG - Intronic
1105633458 13:22194758-22194780 CAGGAGAGGGACCCTGTGGAAGG - Intergenic
1106434264 13:29709832-29709854 CATCAGAAGGAGACTGCAGGAGG + Intergenic
1106475536 13:30095096-30095118 CATGGGAGGGACACTGTGGGAGG + Intergenic
1107004872 13:35598225-35598247 CAGAAGGGGGAGAATGTGGAAGG + Intronic
1107447802 13:40483894-40483916 CATCATAGGGAGACTAGGAAAGG - Intergenic
1107662441 13:42652749-42652771 CATCTGAAGGATACTTTGGAAGG + Intergenic
1107702455 13:43061643-43061665 CAAGAGAGGGAGAGTGTGGTGGG + Intronic
1107737880 13:43417187-43417209 CAACAGAGGGAGACGGGAGACGG + Intronic
1108844396 13:54660145-54660167 CATGTGAGGGAGACTGAGGGAGG - Intergenic
1109209149 13:59514526-59514548 CTCCAGATGGAGACTCTGGATGG + Intergenic
1109790104 13:67235401-67235423 AATTAGAGGGGGACTGTGGGGGG - Intergenic
1110263676 13:73514469-73514491 CATCACAGGTAAACTTTGGATGG - Intergenic
1110695620 13:78484733-78484755 CATGAGAGGGACCCGGTGGAGGG + Intergenic
1111795192 13:92910495-92910517 CCTCAGAGGAAGACTGAGGGAGG + Intergenic
1112020773 13:95369380-95369402 CAGGAGAGGGAGAGTGTGCAGGG + Intergenic
1112142964 13:96666269-96666291 CATCAGAGGGACCTGGTGGAAGG - Intronic
1113286463 13:108854241-108854263 CAGCACAGGGAGACTGTGGTGGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1115718309 14:36130305-36130327 CATGGGAGGGAGCCTGTGGGAGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1117194858 14:53329647-53329669 CAGCAGAGGGGGAATGAGGATGG - Intergenic
1118454447 14:65931887-65931909 CAGCTGAGAGAGACTGAGGAAGG + Intergenic
1118734579 14:68692146-68692168 GATGAGAGGGAGACTGGGGGCGG - Intronic
1119076247 14:71642374-71642396 CACCAGAGGTAGACTGTTTACGG - Intronic
1119257229 14:73208932-73208954 CATGGGAGGGAGACTGAGGAGGG - Intronic
1119431827 14:74573418-74573440 CATCAGTGGGGAACTGTGGCAGG + Intronic
1119815626 14:77564210-77564232 CAACAGAGGGAGACTCTGTCTGG + Intronic
1119917310 14:78413887-78413909 CATGAGAGGGACCCTGTGGGAGG + Intronic
1120269652 14:82295624-82295646 CATGAGAGGGTGTCTCTGGATGG + Intergenic
1121927315 14:97939603-97939625 CATCAAAGAGAGACTATGAAAGG - Intronic
1122090857 14:99339260-99339282 CATGACAGGGACACTGGGGACGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122608698 14:102965935-102965957 CAACAGAGTGAGACTGTCGCGGG + Intronic
1122646940 14:103201108-103201130 CATCAGGGGGATAGTGGGGAGGG - Intergenic
1123667303 15:22617655-22617677 CATCAGAGGGGATCTGTGGCTGG + Intergenic
1124321145 15:28712222-28712244 CATCAGAGGGGATCTGTGGCTGG + Intronic
1124481352 15:30083132-30083154 CATCAGAGGGGATCTGTGGCTGG - Intronic
1124487807 15:30135228-30135250 CATCAGAGGGGATCTGTGGCTGG - Intronic
1124522242 15:30414061-30414083 CATCAGAGGGGATCTGTGGCTGG + Intronic
1124536423 15:30552157-30552179 CATCAGAGGGGATCTGTGGCTGG - Intronic
1124542897 15:30604205-30604227 CATCAGAGGGGATCTGTGGCTGG - Intronic
1124562858 15:30791651-30791673 CATCAGAGGGGATCTGTGGCTGG - Intergenic
1124755721 15:32403093-32403115 CATCAGAGGGGATCTGTGGCTGG + Intronic
1124762228 15:32455435-32455457 CATCAGAGGGGATCTGTGGCTGG + Intronic
1124776401 15:32593633-32593655 CATCAGAGGGGATCTGTGGCTGG - Intronic
1125199674 15:37091884-37091906 CATTATTGGGAGACTGGGGAGGG - Intronic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126911585 15:53422564-53422586 CATCACGGGGAGACTGTGTGTGG + Intergenic
1127287509 15:57544444-57544466 CAACACAGGGAGACTGTGAGGGG - Intronic
1127570156 15:60233863-60233885 CAACAGAGGGAGACTGTCTCAGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128388658 15:67167971-67167993 CAACAGAGGGAGACTCTGTCTGG - Intronic
1128511013 15:68313930-68313952 GGTCTGAGGCAGACTGTGGAAGG + Intronic
1129285742 15:74523094-74523116 AATCAGAGGGAGACAGTCTATGG + Intergenic
1129479364 15:75810822-75810844 CAAGAGAGGGAGACTGTGCTGGG - Intergenic
1130552076 15:84895636-84895658 CAGGAGAGGGAGGTTGTGGAGGG + Intronic
1131455635 15:92580455-92580477 CAGCAGAGGGGGTCTGTGGCTGG - Intergenic
1132806143 16:1776028-1776050 CATGAGAGGGCGCCTGGGGACGG - Intronic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1133608723 16:7413327-7413349 CTACAGAGGAAGACTGGGGAAGG - Intronic
1133693274 16:8236573-8236595 CATGAGAGGGACCCAGTGGACGG - Intergenic
1134600596 16:15530665-15530687 CATGAGAGGGACCCGGTGGAAGG + Intronic
1135079389 16:19421326-19421348 CATGAGAGGGACGCTGTGGGAGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137439221 16:48483868-48483890 AGAGAGAGGGAGACTGTGGAGGG + Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139015446 16:62684180-62684202 CACTGGAGGGAGACTGAGGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139789891 16:69424985-69425007 CCTCAGAGGGAAACTGGGGTGGG + Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140045304 16:71436699-71436721 CAACAGTGGGTGACTGTGGGAGG + Intergenic
1140058943 16:71550516-71550538 CATCAGAGGGACTATGTGCATGG + Intronic
1140991683 16:80219193-80219215 CATGAGAGGGACTCTGTGGGAGG + Intergenic
1141301987 16:82825559-82825581 CAACAGAGGGAGACTCTGTTTGG - Intronic
1141597338 16:85105358-85105380 CAGCTGGAGGAGACTGTGGATGG - Exonic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143814031 17:9496760-9496782 CATCAGAGGGAGTATGAAGAAGG + Intronic
1143900885 17:10173911-10173933 GAGCACAGGGAGACGGTGGAGGG + Intronic
1143940539 17:10536590-10536612 CTTCAGAGGGAGCTGGTGGAGGG - Exonic
1144409866 17:14990536-14990558 CACCAGTGGGAGACTGGGGTGGG - Intergenic
1144638472 17:16925287-16925309 CCCCAGAGGGAGACTCCGGAGGG + Intergenic
1144887117 17:18470884-18470906 CATCAGAGGGAGGGTGCGGGAGG + Intergenic
1145145099 17:20473411-20473433 CATCAGAGGGAGGGTGCGGGAGG - Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146353836 17:32117959-32117981 CATCAGAGGGAGGGTGCGGGAGG + Intergenic
1146369271 17:32254958-32254980 CAGCAGAGGGAGGCTGTGCGTGG - Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147757843 17:42780406-42780428 CCTCAGAGTGAGACTGCGGCCGG + Intergenic
1148250173 17:46071261-46071283 CATCAGAAAGGGACTGTGGCTGG + Intronic
1149370087 17:55985355-55985377 CATGGGAGGGACACAGTGGAAGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG + Intergenic
1152388205 17:79987681-79987703 CCGCAGAGGGAGGCTGTGGCTGG - Intronic
1152795101 17:82302746-82302768 CCTGGGAGGGAGACTGGGGAGGG + Intergenic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1154357577 18:13633511-13633533 CATCAGTGGGAGGCTGAGGCAGG - Intronic
1155079217 18:22391226-22391248 CATCACTGGGAGAATGTGGATGG - Intergenic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1156296597 18:35797400-35797422 CCTTAGAGGGAGACTGTGTTGGG + Intergenic
1157434214 18:47654781-47654803 CATCAGAAGGGGACTGAGTAGGG - Intergenic
1157528725 18:48404965-48404987 CTTCAGTAGGAGGCTGTGGATGG - Intronic
1157849863 18:51038235-51038257 CTACAGAGCGAGACTGTGGGGGG + Intronic
1158739198 18:60120364-60120386 CATTAGAGGGAGATGGGGGATGG - Intergenic
1158868961 18:61665752-61665774 CATCTGAGGGAGAAGGGGGAAGG - Intergenic
1159299871 18:66549241-66549263 AATCAGAGGGAAACTGAGAAAGG + Intronic
1159634665 18:70790091-70790113 CATGAGAGGGAGCTGGTGGAAGG - Intergenic
1160059746 18:75518182-75518204 CCTCAGGGTGAGACTGTGGGTGG + Intergenic
1160405508 18:78643853-78643875 GAGCAGAGGGTGACTGTTGAGGG + Intergenic
1160955181 19:1688049-1688071 CATCGGAGGGCGACTGACGAGGG + Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163279268 19:16305468-16305490 CATCAGAGGAAGCTGGTGGAAGG + Intergenic
1163766301 19:19165246-19165268 CAACAGGGGGAGGCAGTGGAGGG + Intronic
1164148926 19:22532286-22532308 CATCAGAGGGATTCTGGGGCTGG + Intronic
1164169173 19:22709313-22709335 CATCAGAGGGACGCTTAGGATGG + Intergenic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1164725885 19:30465342-30465364 CTTCAGGGGGTGACTGGGGAGGG - Intronic
1164735337 19:30536895-30536917 CATCAGAGCCAGACTCTGAAGGG - Intronic
1164743509 19:30594422-30594444 GAGCAGGGGGAGACTGAGGAGGG - Intronic
1164911534 19:32016230-32016252 CATCAGAGGGACCCAGTGGGAGG + Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166309859 19:41956874-41956896 CACCAGATTGAGGCTGTGGACGG - Exonic
1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG + Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
924970799 2:126228-126250 CATGAGAGGGAAACTGTGGAAGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925572065 2:5323070-5323092 CATGAGAGGGAAAATGTGCACGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
926127695 2:10282066-10282088 CAGCAGAGGGAAGCTGGGGAGGG + Intergenic
926128487 2:10286114-10286136 CAGCAGAGGGAAGCTGAGGAGGG + Intergenic
927554245 2:24021442-24021464 CAGCAGAGGGGGTGTGTGGAAGG + Intronic
927810985 2:26180039-26180061 CAACAGAGGAAAAATGTGGAGGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928378615 2:30799464-30799486 CCTCAGAGGAAGACTATGCAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930341671 2:50123831-50123853 CTTCAGATGGATATTGTGGAAGG + Intronic
933764707 2:85698689-85698711 CAGCAGAGGGAGTCAGGGGAGGG - Exonic
934583809 2:95470743-95470765 CTTTAAAAGGAGACTGTGGATGG - Intergenic
934595643 2:95605971-95605993 CTTTAAAAGGAGACTGTGGATGG + Intergenic
935488026 2:103682166-103682188 CCTCAGTGCTAGACTGTGGAAGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936049185 2:109210483-109210505 CATCCCAGGGAGACAGTGGCTGG + Intronic
937031688 2:118746048-118746070 CATGAGAGGGACACAGTGGGAGG - Intergenic
937051258 2:118893017-118893039 CATAAGAGTGAGTGTGTGGAGGG + Intergenic
937694871 2:124797635-124797657 TATCTCAGGGAGATTGTGGATGG - Intronic
937903170 2:127038145-127038167 CATGAGGAGGAGAGTGTGGAGGG - Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940012743 2:149072176-149072198 AAACATAGGGAGACTGAGGAGGG - Intronic
940599743 2:155843975-155843997 CATGAGTGGGAGAGTGAGGAAGG + Intergenic
940621584 2:156120513-156120535 CATGAGAGGGACCCTGTGGGAGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941449649 2:165644670-165644692 CATCCTAGGGACTCTGTGGAAGG + Intronic
941663178 2:168216250-168216272 AATCAGAGGGAGACAGATGAAGG + Intronic
942950317 2:181713769-181713791 CATTAGAGGGACCCTGTGGGAGG + Intergenic
943489273 2:188530240-188530262 CCTCAGAATGAGACTGTGGTTGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944289609 2:197990658-197990680 CATGGGAGGGACTCTGTGGAAGG - Intronic
945140599 2:206682583-206682605 CATCAAAGAGAGAGTGTAGAGGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946196517 2:218035537-218035559 CAGCAGTGGGACACAGTGGAGGG - Intronic
946200796 2:218069701-218069723 CAGCAGTGGGACACAGTGGAGGG - Intronic
946698277 2:222383963-222383985 CATCAGAAGGACACTGTGGTAGG - Intergenic
947379149 2:229528272-229528294 CATGAGAAGGTGACTGTTGACGG + Intronic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
948450435 2:238067018-238067040 CATCAGAGGGACCCGGTGGGAGG - Intronic
948643341 2:239388786-239388808 CAGCGGAGGGAGTGTGTGGAGGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169246719 20:4031872-4031894 CATCAGAGGGGGGCGGGGGAGGG - Intergenic
1169945247 20:10981155-10981177 CAGAAGTGGCAGACTGTGGAAGG + Intergenic
1171382216 20:24742508-24742530 TCTCAGAGGGAGACTTTGGCAGG + Intergenic
1172025689 20:31946696-31946718 CATCAGAGGCCAACTGAGGAAGG + Intronic
1172896623 20:38304726-38304748 GGTCAGAGGGAGAGTGTGGGAGG + Intronic
1173965452 20:47109138-47109160 CTTCAGGGGGAGACCCTGGATGG - Intronic
1174148035 20:48465791-48465813 CAGGAGAGGGAGACTTTGGGGGG + Intergenic
1174857957 20:54064622-54064644 CAGGAGAGCGAGACTGCGGAGGG - Intronic
1176255049 20:64147300-64147322 CATCTGAGGGAGGCTGCGGCTGG - Intergenic
1177006731 21:15682556-15682578 CAGCAGAGGGAGGTTGTGGTCGG - Intergenic
1178027347 21:28483306-28483328 CATCAGAAGGAGACTCAGGATGG + Intergenic
1178255985 21:31052998-31053020 CATCTGAGAGAGGCAGTGGAAGG + Intergenic
1179598825 21:42461906-42461928 CATCAGAGGCAGGGTGAGGAGGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181957921 22:26601747-26601769 CAGCACTGGGAGACTGTGGAAGG + Intronic
1182364685 22:29770545-29770567 CATCAGAGTGGAACTGTGGCAGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183256967 22:36768727-36768749 CATGAGAGGGAAAATGGGGAGGG - Intronic
1183661495 22:39224141-39224163 AATAGGAGGGAGACTGTGGTAGG - Exonic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184523951 22:45010366-45010388 TATCAGAGGGAGGCGGAGGAGGG - Intergenic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950477549 3:13223518-13223540 CATCAGAGGGAAGCTGGGAATGG + Intergenic
950798466 3:15530513-15530535 CATCAGAAGAAGACAGGGGAGGG - Intergenic
950910980 3:16591539-16591561 CTTCAGAGGGAGGCTGAGGTAGG - Intronic
951793713 3:26515481-26515503 CAACAGAGGGAGACGGGAGAGGG - Intergenic
953823563 3:46230813-46230835 GATCAGAGGGCCAGTGTGGAGGG - Intronic
954349357 3:50030007-50030029 CAACAGAGTGAGACTTTGGGAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
956033160 3:65061310-65061332 AATGAGAGGGAGGCTGTGGTTGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959741994 3:109731133-109731155 CATGAGAGGGACACAGTGGGAGG - Intergenic
959807147 3:110569217-110569239 CATCATAGTGAAACTGTTGAAGG + Intergenic
960012602 3:112849656-112849678 CACCAGAGAGAAACTATGGAGGG + Intergenic
960226220 3:115172328-115172350 CATCACAGGGATAATGTGGTAGG + Intergenic
960499545 3:118419650-118419672 CATGAGAGGGAACCTGTGGGAGG - Intergenic
960662786 3:120079186-120079208 TCCCAGAGGGAGACTGAGGAGGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
961389880 3:126546157-126546179 GGTCAGAGGGAGACTGCGGGAGG - Intronic
961772952 3:129263576-129263598 CATCAGTGGGAGCCAGTGGTAGG + Intronic
961787028 3:129353467-129353489 TATCAGAGGGAAGCTGGGGATGG - Intergenic
961791691 3:129380982-129381004 TTTCAGAGGGAGAGTGGGGAGGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963627210 3:147688830-147688852 CATGGGAGGGACACTGTGGGAGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964412042 3:156408018-156408040 AATCACAGAGAGATTGTGGAAGG + Intronic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967251688 3:187546619-187546641 CATGAGAGGGAGAAGGTGTAGGG - Intergenic
968298552 3:197595723-197595745 CATCACAGGGAGGAAGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
970192997 4:13532921-13532943 CAACAGAGCAAGACTCTGGACGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971546407 4:27891929-27891951 CATCAGAGGGACTCAGTGGGAGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
974085572 4:57257039-57257061 TATCAGAGGTAGACGGTGGTAGG - Intergenic
974179002 4:58360638-58360660 CATGGGAGGGAGACTGAGGTGGG - Intergenic
974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG + Intergenic
974981996 4:68968190-68968212 CATGGGAGGAAGACAGTGGAAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978498427 4:109384459-109384481 CATGAGAGGGAGACTGAGTCAGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979649007 4:123107740-123107762 CATGGGAGGGAGGCTGAGGAGGG - Intronic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
981236214 4:142418854-142418876 CATCAGGTGGAGACTGAGCAGGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
986304105 5:6502821-6502843 CATCAGAGTGTGGCTGTGGGGGG - Intergenic
986659029 5:10042468-10042490 CAGCAGAGGAGGACTGTAGAGGG + Intergenic
986751881 5:10794816-10794838 CATCAGAGTGAGAGGGTGCAGGG - Intergenic
987113788 5:14711328-14711350 CATCAGTGTGGGGCTGTGGATGG + Intronic
988356849 5:30187675-30187697 CATGGGAGGGACACAGTGGAAGG + Intergenic
988525922 5:31987476-31987498 CATCAGAGGCAGCCTGAGGATGG + Intronic
989425453 5:41290911-41290933 CATGGGAGGGAGACTGAGCAGGG - Intergenic
989503562 5:42198559-42198581 CATCAGATGGAGGCTGGGTATGG - Intergenic
989545342 5:42665981-42666003 CATGAGAGGGAGCTGGTGGAAGG - Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990190112 5:53250051-53250073 CAGCTGAGGGAGAGTGTAGAGGG - Intergenic
991201641 5:64001033-64001055 TATCAGAGAAGGACTGTGGATGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992186920 5:74252845-74252867 CCTCATAGGGTGATTGTGGAAGG + Intergenic
993923542 5:93837347-93837369 CATCAGTGGTAGACTGCAGAAGG - Intronic
994814135 5:104562554-104562576 CATCTGAGGAAGTTTGTGGAAGG - Intergenic
995558944 5:113360021-113360043 CATAAATGGGAGACTGTGAATGG + Intronic
996164575 5:120209385-120209407 CAACAGAGTGAGACTGTGCCTGG + Intergenic
998885615 5:146690979-146691001 CACCAGAGAGAGACTGGGGTAGG + Intronic
999125048 5:149240279-149240301 AACCTGAGGGTGACTGTGGATGG - Intronic
999266372 5:150269457-150269479 CTCAAGAGGGAGACTGAGGAGGG - Intronic
999973871 5:156891752-156891774 CATCATAGGGAGAATGAGGCTGG - Intergenic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1001890316 5:175333008-175333030 CACAAGAAGGAGACTGTGGTGGG - Intergenic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003528474 6:6917993-6918015 AAGCAGAGGGAGAATTTGGAAGG + Intergenic
1004626158 6:17379286-17379308 CATCAGTGGGTGCCTGGGGATGG + Intergenic
1004813067 6:19281074-19281096 AATCAAAGGGAGAGTGAGGAAGG + Intergenic
1005497954 6:26405231-26405253 AATCAGAGGGGGATTGTGGTGGG + Intronic
1006674932 6:35755907-35755929 CATCAGAGGGAAACTCTGATTGG - Intergenic
1006679544 6:35787267-35787289 CTTCTGGGGGAGCCTGTGGACGG + Intronic
1006832308 6:36976366-36976388 TAACAGAGGGAGCCAGTGGAAGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009243410 6:61205162-61205184 CATGGGAGGGAGACTGAGGGGGG - Intergenic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1009608250 6:65902393-65902415 CATCAATGGGAGAGTGAGGATGG - Intergenic
1011391328 6:86857120-86857142 CATCAGATTTATACTGTGGAAGG + Intergenic
1011498418 6:87961664-87961686 CATCATAGGGAGACTGTGCCTGG - Intergenic
1012192432 6:96297051-96297073 CAGAAGAGGGAGACTGTGAGGGG + Intergenic
1012253666 6:97008177-97008199 CAGCAGAGGGAGGTTGTGGTGGG + Intronic
1013143377 6:107363229-107363251 CATCAGAGACAAACTGTTGAAGG + Intronic
1013415948 6:109924599-109924621 GATCAGAAGTAGACTGTGGTGGG + Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013675993 6:112463793-112463815 CATGAGAGGGACCCAGTGGAAGG + Intergenic
1013751705 6:113414693-113414715 CAACAGAGGGAGCCTGGAGATGG + Intergenic
1013938510 6:115630817-115630839 CAGCAGAGGAAGCCTGTGTATGG + Intergenic
1014827548 6:126063869-126063891 CATCAGAGTGGGACTGGGGTCGG + Intergenic
1015240074 6:131012183-131012205 CAACTGAGGGAGACTCTAGATGG + Intronic
1016738989 6:147508748-147508770 CATCAGAAGAAGCCTGAGGAAGG - Intergenic
1018472931 6:164112401-164112423 CATGGGAGGGACTCTGTGGAAGG + Intergenic
1018602875 6:165563985-165564007 GATCAGTGGGAGAGGGTGGAGGG - Intronic
1019057833 6:169235898-169235920 GGACAGAGGGAGAGTGTGGATGG - Intronic
1019352917 7:563329-563351 CTGCAGAGGCAGCCTGTGGAGGG - Intronic
1019379047 7:711975-711997 GATGAGGGTGAGACTGTGGATGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019505396 7:1388053-1388075 CCTCGGAGGGACACTGTTGAGGG - Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1024008098 7:45242000-45242022 CATCATAGGGAGGCAGTGGTGGG - Intergenic
1024263174 7:47587048-47587070 CAGGAGAGGGAGCCTGGGGAGGG + Intergenic
1024598490 7:50960064-50960086 GATCAGAGGAGGACTGTGGAGGG - Intergenic
1024826922 7:53401114-53401136 CATGAGAGGGACTCGGTGGAAGG - Intergenic
1025775000 7:64553609-64553631 CATCAGAGGGAGACAGGAGAGGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026316269 7:69230413-69230435 CCTCAGTGGGAGACTGAGGTGGG - Intergenic
1026373057 7:69721171-69721193 GATCAGAGAGAGATTGTGGGAGG - Intronic
1030465998 7:109904884-109904906 CTTCAGAGGAATACTGTGCAAGG + Intergenic
1031645449 7:124220486-124220508 CATGAGAGGGACCCAGTGGAAGG + Intergenic
1031772768 7:125865959-125865981 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1032332175 7:130990779-130990801 CAGCAGAGGGAGATGGTGCAGGG - Intergenic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035734794 8:1880334-1880356 CGTAAGAGGGAGACAGTGAAAGG - Intronic
1036003869 8:4639284-4639306 CATCAGAGGCAGACTGTTACAGG - Intronic
1036422842 8:8613948-8613970 AGTCAGAGGGAGGCAGTGGAAGG + Intergenic
1036434457 8:8720525-8720547 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1037726854 8:21490033-21490055 CTTCAGAGGTAAACTTTGGATGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038624279 8:29175687-29175709 CAACAAAAGGAGTCTGTGGAAGG + Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040570520 8:48605378-48605400 AATCATAAGGAGACTGTGAATGG + Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041938230 8:63358155-63358177 AATGAAAGGAAGACTGTGGAAGG - Intergenic
1043675872 8:82952990-82953012 CAAGAGAGGGAGAGTGAGGAGGG - Intergenic
1043821528 8:84871683-84871705 CCTCAGAGGGATACTCTAGAGGG + Intronic
1043917593 8:85940538-85940560 CAACAGAGAGAGAATGAGGAAGG + Intergenic
1044203907 8:89468983-89469005 CATCAGAGCCACACTGTGTAAGG + Intergenic
1044804763 8:95993720-95993742 CATAAGAAGGAGTCTTTGGAGGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045572210 8:103379840-103379862 GATCTGAGGGAAAATGTGGAGGG - Intronic
1046391341 8:113576840-113576862 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047757806 8:127932018-127932040 CAACAGAGGAAGCCTGAGGATGG - Intergenic
1047885077 8:129241244-129241266 CATCAGAGGCACATTGTGGATGG + Intergenic
1048037717 8:130693275-130693297 CAGCAGAGGAAGACTGTCAAGGG - Intergenic
1050277729 9:4017588-4017610 GATCAGAGAGAGGCTGTGAAAGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051266019 9:15308973-15308995 CAGCACTGGGAGACTGAGGAAGG + Intergenic
1051683253 9:19629854-19629876 CTTCAGTGGGAGAGTGTGAATGG + Intronic
1054257980 9:62834072-62834094 CAGCAGAGGAAGACTGGGGCAGG - Intergenic
1057194797 9:93110951-93110973 CATGAGAGAGAGACGGAGGAAGG - Intronic
1057432810 9:95010350-95010372 CAACAGATGGTGACTGTGGTAGG + Intronic
1057470455 9:95351576-95351598 CAGCAGATGTTGACTGTGGATGG - Intergenic
1057492878 9:95536065-95536087 CATCAGTGGTAGACTGGGTAAGG + Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1058650595 9:107172285-107172307 CATCAGAGGTGGACTTAGGATGG - Intergenic
1060935003 9:127509620-127509642 CCCAAGATGGAGACTGTGGAAGG + Intronic
1060984976 9:127814751-127814773 CCCCAGAGTGAGAGTGTGGATGG + Intergenic
1062631098 9:137463519-137463541 CACCACAGGGAGCCTGGGGAGGG + Exonic
1202800793 9_KI270719v1_random:174308-174330 CAGCAGAGGAAGACTGGGGCAGG + Intergenic
1186191523 X:7071595-7071617 CATCATAGGGGAACTGGGGATGG - Intronic
1186824524 X:13326070-13326092 CATCATAGTGAGTCTGTGAAAGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189798060 X:44664795-44664817 CATAAGAGGGACCCTGTGGGAGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190023767 X:46903665-46903687 CAGCAGAGTGAGACTGAGTAGGG + Intergenic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1190489718 X:50969541-50969563 CAACATAGCGAGACTGTGGCAGG - Intergenic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192350313 X:70350463-70350485 CAACAGAGGGAGACGGGAGAGGG + Intronic
1192584530 X:72308739-72308761 TATCAGAGGGAGACTAGGCAGGG - Intergenic
1194358979 X:92923882-92923904 TATCAGAGGATGACTGTGTAGGG + Intergenic
1194665965 X:96677976-96677998 CATCAGATGAAGTCTGTGAAAGG - Intergenic
1194756441 X:97744171-97744193 CATGGGAGGGACACTGTGGAAGG + Intergenic
1198006243 X:132497433-132497455 CATTAGTGAGAGAATGTGGAAGG + Intergenic
1199491783 X:148407949-148407971 TATCAAAGGGAGAATGTAGATGG - Intergenic
1200226213 X:154419323-154419345 CATTGGAGGGCGTCTGTGGATGG + Intronic
1201374753 Y:13306810-13306832 CATCGGAGGGAGACTGAGGCAGG - Intronic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1202374202 Y:24218344-24218366 CATCAGAGGGGATCTGTGGCTGG + Intergenic
1202496579 Y:25451776-25451798 CATCAGAGGGGATCTGTGGCTGG - Intergenic