ID: 917306801

View in Genome Browser
Species Human (GRCh38)
Location 1:173634837-173634859
Sequence TAGTGGGTGAGGGGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 985
Summary {0: 1, 1: 0, 2: 4, 3: 86, 4: 894}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917306801_917306813 20 Left 917306801 1:173634837-173634859 CCTTCCTCACCCCTCACCCACTA 0: 1
1: 0
2: 4
3: 86
4: 894
Right 917306813 1:173634880-173634902 ACCACAGGAATATATTATAAGGG 0: 1
1: 0
2: 1
3: 20
4: 261
917306801_917306812 19 Left 917306801 1:173634837-173634859 CCTTCCTCACCCCTCACCCACTA 0: 1
1: 0
2: 4
3: 86
4: 894
Right 917306812 1:173634879-173634901 CACCACAGGAATATATTATAAGG 0: 1
1: 0
2: 0
3: 10
4: 172
917306801_917306815 25 Left 917306801 1:173634837-173634859 CCTTCCTCACCCCTCACCCACTA 0: 1
1: 0
2: 4
3: 86
4: 894
Right 917306815 1:173634885-173634907 AGGAATATATTATAAGGGACAGG 0: 1
1: 0
2: 5
3: 16
4: 272
917306801_917306809 5 Left 917306801 1:173634837-173634859 CCTTCCTCACCCCTCACCCACTA 0: 1
1: 0
2: 4
3: 86
4: 894
Right 917306809 1:173634865-173634887 TAGTACCACATCACCACCACAGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917306801 Original CRISPR TAGTGGGTGAGGGGTGAGGA AGG (reversed) Intronic
900079214 1:843010-843032 TAGTGGCTGTGGGGTGGGGCTGG - Intergenic
900154054 1:1197049-1197071 CAGTGGGCTCGGGGTGAGGAGGG + Intronic
900638197 1:3675887-3675909 CAGGTGGTGAGGGGAGAGGATGG + Intronic
900973605 1:6004921-6004943 TGCTGGCTGAGGGGTGAGGGTGG + Intronic
901490540 1:9594334-9594356 CAGGGGGTGTGGGGTGAGAAGGG + Intronic
902262069 1:15233692-15233714 TAGAGGGTGTGGGGGCAGGAGGG - Intergenic
902972374 1:20063089-20063111 TGGAGGGTGAGGTGGGAGGATGG + Intronic
903074417 1:20751615-20751637 GAAAGGGTGAGGGGGGAGGATGG + Intronic
903262876 1:22140880-22140902 TGTTGGGGGTGGGGTGAGGAGGG - Intronic
904036816 1:27563535-27563557 TGATGGGGGAGGGGTGAGGTGGG - Intronic
904128681 1:28260092-28260114 GAGTGGGGGAGGGGTGCCGAGGG - Intronic
904255964 1:29255093-29255115 TAGAGGGAGAGGGTGGAGGAGGG + Intronic
904353498 1:29924049-29924071 TTGTGGAGGAGGGGAGAGGAAGG - Intergenic
904365241 1:30006880-30006902 TAGGGGGTGAGGGCTGGGGGAGG - Intergenic
904433441 1:30479521-30479543 GGCTGGGGGAGGGGTGAGGAAGG - Intergenic
904563051 1:31411603-31411625 TAGTGGGTTGGGGGTGAGGGTGG + Intronic
904582325 1:31553846-31553868 GAGTGGGGGAGGGGGGTGGAAGG - Intergenic
904617520 1:31757969-31757991 GAGTGGGTAAGGGCTGAGGATGG + Intronic
905014510 1:34768082-34768104 CAGTGTGTGGTGGGTGAGGAGGG - Intronic
905183971 1:36183057-36183079 TGGTGGGTGATGGCTGAGGAGGG - Intergenic
905359143 1:37406454-37406476 TCGTGGGTGCTGGGTCAGGAGGG + Intergenic
905793998 1:40805243-40805265 TGGTGGGGGAGAGGGGAGGAGGG - Intronic
906154005 1:43603532-43603554 AGGTGAGTGAGGGGTCAGGACGG + Exonic
906390997 1:45416185-45416207 TAGAGGCTGAGGTGGGAGGATGG - Intronic
906475853 1:46168844-46168866 TAGTGTGTGTGTGTTGAGGAGGG - Intronic
906562028 1:46765477-46765499 AAGTGGGTGGAGGGTGGGGAAGG - Intronic
906923178 1:50086744-50086766 TGGAGGGTGCGGGGTGTGGAGGG - Intronic
907053034 1:51342595-51342617 TGGTGGGCGAGGGGTGAGGGTGG + Intronic
907471754 1:54678881-54678903 CGGAGGGTGGGGGGTGAGGAGGG + Intronic
907731235 1:57068045-57068067 CAGTGGGGGCGGGGTGGGGAGGG - Intronic
907858430 1:58326822-58326844 TAGGGGCTGAGGGGTTTGGAAGG - Intronic
907888896 1:58619526-58619548 TTGTGGGGGAGGGGTAAGGAAGG + Intergenic
908344268 1:63215576-63215598 CAGTGGGTGGGGGGTGGGTAGGG + Intergenic
908580860 1:65515105-65515127 TGGTGGGTGATGGTTGAGGGAGG + Intronic
908681186 1:66663214-66663236 AAGTGGGTGGGGGATGGGGAGGG - Intronic
908774097 1:67623884-67623906 GAGAGGCTGAGGTGTGAGGATGG - Intergenic
909014254 1:70366186-70366208 AAATGGTTGAGGGGTGAGTAAGG - Intronic
910108354 1:83655520-83655542 AAGAGGCTGAGGGGCGAGGATGG - Intergenic
910146928 1:84091069-84091091 TAGTAGGTGAGCGATGAGAAAGG - Intronic
910210902 1:84791900-84791922 TAGTGGCTGAGGTGTGGGGCCGG + Intergenic
910673296 1:89794729-89794751 TGGGGGGTGGGGGGTGGGGATGG + Intronic
910981820 1:92965680-92965702 GAGTAGGTGAGGAATGAGGAAGG + Intergenic
911337618 1:96599687-96599709 TAGAGGCTGAGGAGGGAGGATGG + Intergenic
911760993 1:101616541-101616563 CAGTAGGTGCGGGGTGAGGTTGG + Intergenic
912573572 1:110643301-110643323 TTGGGGGTGGGGGGTGAGGTGGG - Intergenic
912762536 1:112381997-112382019 TGGTGGGTGAGGGGAAAGAAGGG + Intergenic
913492440 1:119393705-119393727 TCATGGGTAAGGGGTGATGAAGG - Intronic
913710203 1:121475026-121475048 GAGTGGGGAAGGGATGAGGAAGG - Intergenic
914243315 1:145867259-145867281 TTGTGGGTTAAGGGTGATGAGGG - Intronic
914329912 1:146658171-146658193 TGGTGGCTGAGGTGGGAGGATGG - Intergenic
914747341 1:150510019-150510041 TAGTGGGATAGAGGTGAGGGAGG - Intronic
915047857 1:153033645-153033667 TACAGGGAGAGGGGTGAGGGTGG - Intergenic
915074786 1:153299096-153299118 TTGTAGGTAAGGGGTGAGCATGG - Exonic
915152114 1:153842076-153842098 TAGTGGCTGAGGTAGGAGGATGG - Intronic
915495416 1:156279219-156279241 TGGTGGGCGGGGGGTGGGGAGGG - Intronic
915601372 1:156924828-156924850 TCGGGGGTGGGGGATGAGGAAGG + Intronic
915830990 1:159129950-159129972 AAGTGAGTGAGAAGTGAGGAAGG - Intronic
915920441 1:159972211-159972233 GTGTGGGTGAGGGGCGAGGCGGG - Intergenic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
916053100 1:161049524-161049546 GAGTGGGTGGGGGCAGAGGATGG - Exonic
916053655 1:161052863-161052885 TAGTTGGCGAGGGGTGATGAAGG - Intronic
916124012 1:161553210-161553232 GATTGGCTGAGGGGTGATGAAGG + Intergenic
916133895 1:161634572-161634594 GATTGGCTGAGGGGTGATGAAGG + Intronic
916429741 1:164715996-164716018 TAGTGGGGAGGTGGTGAGGAGGG + Intronic
917306801 1:173634837-173634859 TAGTGGGTGAGGGGTGAGGAAGG - Intronic
917444944 1:175099318-175099340 TGAGAGGTGAGGGGTGAGGACGG + Intronic
917859509 1:179132852-179132874 TGGTGGGAGAGGGGTGCGGACGG - Intronic
918082445 1:181217999-181218021 AGATGGGTGAGGGTTGAGGAGGG + Intergenic
918267739 1:182861518-182861540 TAGTGGTAGAAGGGAGAGGAAGG - Intronic
918539269 1:185610619-185610641 GAGTGGGGGAGAGGTAAGGATGG + Intergenic
918610025 1:186478753-186478775 TGGTGGGAGAGGGGTGAGGAAGG + Intergenic
918940834 1:190994156-190994178 TAGTGGGGGTGGGATGGGGATGG - Intergenic
919272395 1:195364660-195364682 GAATGGGAGAGAGGTGAGGATGG + Intergenic
919518028 1:198551027-198551049 TAGTGGGAGAAGGAGGAGGAAGG + Intergenic
919770163 1:201153659-201153681 GTGCGGGTGAGGAGTGAGGAAGG - Intronic
919776476 1:201197391-201197413 TAGTGAGGGAGGGGAGGGGAGGG + Intronic
920067875 1:203282028-203282050 GAGTGGGAGAGGGGCAAGGAGGG - Intergenic
920109238 1:203575463-203575485 GAGTGAGGGTGGGGTGAGGATGG - Intergenic
920328665 1:205187845-205187867 TAGAGAGAGAGGAGTGAGGAAGG + Intronic
920386866 1:205575713-205575735 AAGTGGGAGAGGGAAGAGGAAGG - Intronic
920507287 1:206525511-206525533 AGGTGGGTGAGGCGAGAGGATGG - Intronic
921186903 1:212678199-212678221 TGGAGACTGAGGGGTGAGGAGGG - Intergenic
921621872 1:217334301-217334323 CAGTGTATGAGGGGAGAGGAAGG - Intergenic
922129843 1:222766743-222766765 AAGTGGGTGCGGGCTGAGGTGGG + Intergenic
922448472 1:225717667-225717689 TACTGGGTTAGTGGTCAGGAGGG - Intergenic
923797725 1:237174507-237174529 TAGTGGGTGAACAGTGAGGGAGG - Intronic
923907918 1:238406392-238406414 TAGTGAGATAGGGCTGAGGAGGG - Intergenic
924070283 1:240270825-240270847 TAGAGGCTGAGGGGACAGGATGG + Intronic
924777302 1:247119172-247119194 TGGTGGGTACCGGGTGAGGATGG - Intergenic
1062895462 10:1099898-1099920 GAGTGGTGGAGAGGTGAGGAGGG + Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1064794153 10:18992333-18992355 TAGTGGGGGAGAAGTGGGGATGG + Intergenic
1064816257 10:19267405-19267427 TAATGTGTGAGGGGTGGGGGAGG - Intronic
1065043073 10:21717391-21717413 TGGCGGGTGGGGGGTGGGGAGGG + Intronic
1065726885 10:28676428-28676450 AAGGGGGTGGGGGGTGGGGAAGG - Intergenic
1066498399 10:35965112-35965134 GAGTGGCTGAGGTGGGAGGATGG - Intergenic
1067258576 10:44666553-44666575 TGGTGAGTGGGGGGTGGGGAGGG + Intergenic
1067608047 10:47684420-47684442 TTTTGGGGGGGGGGTGAGGAGGG + Intergenic
1067719776 10:48719632-48719654 GGCTGGGTGAGGGCTGAGGAAGG + Intronic
1067920905 10:50456326-50456348 GAGTAGGTAAGGGGTGAGGGAGG - Intronic
1068609924 10:59047963-59047985 TACTAGGTGGGGGGTCAGGAGGG - Intergenic
1069720135 10:70544568-70544590 TCCTGGATGTGGGGTGAGGAGGG + Intronic
1069720397 10:70545842-70545864 TAGGGCTGGAGGGGTGAGGAGGG - Intronic
1069941828 10:71961978-71962000 GAGCGGGTGAGGGGTGGAGATGG + Intergenic
1070127897 10:73636558-73636580 TGGAGGGTGAGGTGGGAGGATGG - Intronic
1070183716 10:74039443-74039465 TAGGTGGTGAGGGGAGAGCAGGG - Intronic
1070271015 10:74955021-74955043 TGGTGGTAGAGGGGTGAGGGAGG - Intronic
1070653611 10:78255583-78255605 CAGTTGTTGAGTGGTGAGGAAGG - Intergenic
1071014974 10:80986416-80986438 TGGTGGGAATGGGGTGAGGAGGG - Intergenic
1071028738 10:81146387-81146409 CAGAAGGTGAAGGGTGAGGAAGG - Intergenic
1071727755 10:88217030-88217052 TAGGGGGTGAGGGGTGGGATGGG + Intergenic
1071971415 10:90911501-90911523 TAGGGGGTGGGGTGGGAGGAAGG + Intergenic
1072024867 10:91445325-91445347 TAGTGGCAGAGGGATAAGGAAGG - Intronic
1072544462 10:96424163-96424185 TAGTGGGGGACTGGTGGGGAAGG + Intronic
1072545753 10:96436788-96436810 GGGAGGGTGAGGGGGGAGGATGG - Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1073904909 10:108267354-108267376 TGGTGGGGGTGGGGTGAGGTGGG - Intergenic
1073941755 10:108707219-108707241 TAGTGGTTGGGGGGTGGGGGTGG + Intergenic
1074180616 10:111059696-111059718 TGGTGGATGAGGGATGTGGAGGG - Intergenic
1074375928 10:112940684-112940706 TTTGGGGTGGGGGGTGAGGAAGG + Intergenic
1074403703 10:113163204-113163226 GAGGGTGGGAGGGGTGAGGAAGG + Intronic
1074430128 10:113387274-113387296 TGGTGGGGATGGGGTGAGGAGGG - Intergenic
1074885425 10:117689290-117689312 TGCTGGGTGAAGGGAGAGGAGGG + Intergenic
1074960140 10:118437255-118437277 TGGTGGGAGAGGGATGAGTAGGG - Intergenic
1075154188 10:119960484-119960506 AAGGAGGGGAGGGGTGAGGAGGG + Intergenic
1075246367 10:120825527-120825549 TTGTGGGGGAGGGGCGAGGGCGG + Intergenic
1075447230 10:122521550-122521572 TGGTGGGTGAGGGGAGGAGACGG - Intergenic
1075494900 10:122911578-122911600 TAGTGGCTGTGTGGGGAGGAAGG + Intronic
1075619226 10:123913674-123913696 AAGTGGGTGTGAGGAGAGGAAGG + Intronic
1075930034 10:126288083-126288105 CAGTGTGTGACAGGTGAGGAGGG - Intronic
1076113078 10:127875377-127875399 GAGTAGGTGTGGGGTGGGGAAGG + Intergenic
1076934738 10:133559778-133559800 TAGCGGGTGAGGGGGAAGGAAGG + Intronic
1077375203 11:2202445-2202467 GGGTGGGGGAGGGGCGAGGAGGG - Intergenic
1077659497 11:4054793-4054815 TCATGGGTGTGGGGAGAGGAGGG - Intronic
1077879616 11:6338622-6338644 AAGTGGGTTGGGGGTGGGGAAGG - Intergenic
1077901657 11:6494967-6494989 TAGGGGGTGGGGGGTGTGGGGGG - Intronic
1077924138 11:6663617-6663639 CAAAGGCTGAGGGGTGAGGATGG + Intergenic
1078039887 11:7850419-7850441 GAGGGGGTGAGGGGTGAGTAGGG + Intergenic
1078234652 11:9472986-9473008 TAGTGGGAGAGAGGAGAGCAGGG + Intronic
1078916784 11:15785776-15785798 TAGCTGGTGAGGGTTTAGGAGGG - Intergenic
1078999524 11:16739484-16739506 TATGAGGTGAGGGCTGAGGAAGG - Intronic
1079165998 11:18044038-18044060 TAGTTGGTGTGGGGAGAGGAGGG + Intergenic
1079309939 11:19356265-19356287 TATAGGGTCAGGGGGGAGGATGG + Intronic
1079405353 11:20140452-20140474 TTGTGGCTGAGGGTTGAGAAGGG + Intergenic
1079819665 11:25109558-25109580 TAGAGGGTGAAGGGAGAGGAAGG - Intergenic
1080017124 11:27519255-27519277 TGGGCAGTGAGGGGTGAGGAAGG + Intergenic
1080191346 11:29552895-29552917 GACTGGGTGTGTGGTGAGGAGGG + Intergenic
1080435331 11:32235748-32235770 GGGTGGGATAGGGGTGAGGAGGG - Intergenic
1081534321 11:43986300-43986322 GAGTGGGTGGGGGGTGGGGGTGG - Intergenic
1081549567 11:44098758-44098780 TGGTGGGTGGTGGGAGAGGAGGG + Intronic
1081621159 11:44619910-44619932 CAGTGGGAGAGGGGAGAGGGTGG + Exonic
1081668768 11:44931815-44931837 TTGTGGGGGAGGGGTGGGCAGGG + Exonic
1081867941 11:46369895-46369917 CACTGGGTGAGGGGTGGGCAGGG - Intronic
1081915994 11:46730530-46730552 CAGTGGGTGAGGGGAGAGAGGGG + Intronic
1082259736 11:50069528-50069550 AAGAGGCTGAGGGGGGAGGATGG + Intergenic
1082998137 11:59268759-59268781 CAGTGGGTGCTGGGTGATGAAGG + Intergenic
1083050604 11:59772946-59772968 CAGGGGGTGAGGGGTGAGAAAGG - Intronic
1083077786 11:60058702-60058724 GGATGGGTGAGGGGTGAGGCAGG + Intronic
1083159232 11:60844400-60844422 TAGTGATGGAGGGGAGAGGAGGG - Intronic
1083309189 11:61775836-61775858 TATGCTGTGAGGGGTGAGGAGGG + Intronic
1083929828 11:65835333-65835355 TAGGGGGTGGGAGGTGAGGGCGG + Intronic
1084488538 11:69464857-69464879 GAGTGGGTGATGGGTGGGGCCGG + Intergenic
1084551257 11:69843487-69843509 GAGTGGGTGGTGGCTGAGGATGG + Intergenic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085244715 11:75090909-75090931 TAGTGGGCGGGGGGAAAGGAGGG + Intergenic
1085258170 11:75188914-75188936 CAGTGGGTGGGAGGAGAGGAAGG - Intronic
1085471126 11:76758776-76758798 GAGAGGGTGTGGAGTGAGGAAGG + Intergenic
1085766476 11:79287533-79287555 TAATGAGTTGGGGGTGAGGAAGG + Intronic
1085883617 11:80496790-80496812 GATTGGGTGAGGGTTGAGGTGGG + Intergenic
1086461436 11:87009479-87009501 TGATGGGAGAGGGGTGCGGAGGG + Intergenic
1087316462 11:96609216-96609238 TCGGGGGTGAGGGGAGGGGAGGG - Intergenic
1087367053 11:97233373-97233395 TGGTGGCTGAGGTGGGAGGATGG - Intergenic
1087435316 11:98109859-98109881 TTGTGTGTGTGGGGTGAGGTAGG + Intergenic
1087990657 11:104743098-104743120 TAGTGGGGCAGGGGTGGGGATGG + Intergenic
1088444423 11:109909410-109909432 GAGAGGGTGAGGTGGGAGGATGG - Intergenic
1088799073 11:113289210-113289232 TAGTGGGGTAGGGGTGGGGAGGG - Intergenic
1089116456 11:116099167-116099189 TACTGGGGTAGGGGGGAGGATGG - Intergenic
1089773203 11:120817802-120817824 CAGGGGGTGAGGGCTGAGGAAGG - Intronic
1089984985 11:122804203-122804225 AACTGGGTGAGAGGTGGGGATGG + Intronic
1090003067 11:122978622-122978644 TGGTCGGAGAGGAGTGAGGAAGG + Intronic
1090102340 11:123812652-123812674 GGGTGGGAGGGGGGTGAGGATGG - Intergenic
1090170109 11:124594231-124594253 TATTGGGTGCGGGGTTAGGGAGG + Intergenic
1090239322 11:125170959-125170981 CAGTGGGGGAGGGGGGAGGCTGG + Intronic
1090418106 11:126554889-126554911 AAGTGGCTGAGTGGTGAGCAGGG + Intronic
1090488933 11:127140767-127140789 TAGAGGCTGAGGTGGGAGGATGG + Intergenic
1090689944 11:129170316-129170338 TGGAGGGTGAGGGGAGGGGACGG - Intronic
1090714264 11:129416277-129416299 TGGTTGTTGAGGAGTGAGGAGGG + Intronic
1091203446 11:133800526-133800548 GAGGGGGTGACAGGTGAGGAAGG + Intergenic
1091209292 11:133842915-133842937 CAGTGGGTGTGGGGTGATGCAGG - Intronic
1091446202 12:545599-545621 TAGAGGGGTAGGGGTGAGGGAGG - Intronic
1091822961 12:3490479-3490501 TGGTGGGGGAAGGGTGAGGAGGG + Intronic
1092097350 12:5853881-5853903 TGGGGGGTGGGGGGTGGGGACGG - Intronic
1092202575 12:6595407-6595429 GAGTTAATGAGGGGTGAGGAAGG - Exonic
1092253815 12:6915690-6915712 CAGTGGGTGGGGGGTGGGTAGGG - Exonic
1092522090 12:9285715-9285737 TAGGGGGTGAGGAGTGGGGGTGG + Intergenic
1092545192 12:9446141-9446163 TAGGGGGTGAGGAGTGGGGGTGG - Intergenic
1093057473 12:14568990-14569012 CAGTGGGAGAGGGGGAAGGAGGG + Intergenic
1094507755 12:31075908-31075930 TAGGGGGTGAGGAGTGGGGGTGG + Intronic
1094526569 12:31234966-31234988 TAGAGGGGGAGGGAAGAGGAGGG + Intergenic
1094536672 12:31327262-31327284 TAGAGGGTGGGGAGAGAGGAAGG + Intergenic
1094599761 12:31898203-31898225 GAGTGGGGGAGGGGAGGGGAGGG + Intergenic
1095085793 12:38056520-38056542 GAGGGGGTGTGGGGTGAGGACGG - Intergenic
1095267932 12:40181536-40181558 CAGTGGGTGTGTGGTGGGGAAGG + Intergenic
1095998058 12:48105989-48106011 AGCTGGGGGAGGGGTGAGGATGG - Exonic
1096487792 12:51995257-51995279 TGGTGGGTTTGGGGTGGGGAAGG + Intronic
1096598194 12:52710729-52710751 TTTTGGGTGAGGGGTCTGGAGGG + Intergenic
1096737838 12:53669818-53669840 TTGGGGGTGATGGGTGGGGAGGG - Intronic
1096815211 12:54197540-54197562 TAGCAGGGGAGGGGTGGGGAAGG + Intergenic
1096868623 12:54579509-54579531 TAGTGGGAGAGAGGAAAGGAGGG - Exonic
1096986977 12:55766165-55766187 TAGTGGGGGAGGGATGAAGAAGG - Intronic
1097410679 12:59248721-59248743 TAGGAGGTGGGGAGTGAGGATGG + Intergenic
1097701810 12:62828019-62828041 CAGTGGGTGAGGGAACAGGAAGG + Intronic
1098249614 12:68555773-68555795 CAGTGGGAGAGAGGTGGGGATGG + Intergenic
1098850782 12:75593730-75593752 TAGTGGGTGGGGGATGAGGATGG - Intergenic
1099141254 12:78978356-78978378 TATTGGGTGAGGGGTTAGAGGGG + Intronic
1099257651 12:80334083-80334105 TTGTGGGTAAGGTGTAAGGAGGG + Intronic
1099348207 12:81529824-81529846 TAGAGGGTGAGAGGTGAGAGAGG + Intronic
1099354144 12:81611931-81611953 TCGTGGGAGAGGGGTGAGTGAGG - Intronic
1099617172 12:84950811-84950833 GAGTGGGAGGAGGGTGAGGATGG + Intergenic
1099686289 12:85893502-85893524 TAGTGGGGTTGGGGTGAGGGAGG - Intergenic
1099883348 12:88496579-88496601 TAGTGGGATATGGGTGAGCATGG + Exonic
1100188668 12:92165974-92165996 TAGTGGGTGATGGATGTGCAGGG - Intergenic
1100671965 12:96823549-96823571 TAGTGGGAGATGGCTCAGGAAGG + Intronic
1101063069 12:100991479-100991501 TAGGGGGTGAGGTGGGAGGAGGG + Intronic
1101623696 12:106417320-106417342 GAGTGAGTGAGGTGTCAGGATGG + Intronic
1101940787 12:109097836-109097858 TAGGGGGTGAAGGGGGAGGAAGG + Intronic
1102005675 12:109587892-109587914 TAGTGGGTAGGGGCTGGGGATGG - Intronic
1102169840 12:110834000-110834022 TAGGGGGTGAGTGGTGATCAGGG + Intergenic
1102555005 12:113720947-113720969 GAGTGGGAGAAGGGAGAGGAGGG + Intergenic
1102677659 12:114669149-114669171 TGGCGGGTGGGGGGTGGGGAGGG + Intergenic
1102942792 12:116958795-116958817 TACTGGTTGGGGAGTGAGGAGGG - Intronic
1103239039 12:119398055-119398077 AAGGGGGTGGGGGGAGAGGAAGG + Intronic
1103666415 12:122570178-122570200 TGATGGGTGAGAGGTGGGGATGG + Intronic
1103797788 12:123516712-123516734 TGGTGGATGAGGGGGGATGAGGG + Intronic
1104202721 12:126607389-126607411 CTGGGGGTGAGGGTTGAGGATGG - Intergenic
1104296439 12:127519043-127519065 TAGTGGGTGAGGTCAGGGGAGGG - Intergenic
1104460718 12:128953661-128953683 TTGTGTGTGTGGAGTGAGGAAGG + Intronic
1104841835 12:131829294-131829316 TACTGGGTGTGGAGTGAGGAAGG - Intronic
1104924856 12:132308815-132308837 CCGTGGGTGAGGTGTGAGGACGG - Intronic
1104962271 12:132493871-132493893 TGGTGGTTGTGGGCTGAGGAGGG + Intronic
1105520891 13:21130031-21130053 GAGTGAGTGAGGACTGAGGATGG + Intergenic
1105828916 13:24146857-24146879 TGGTGGGGGAGGGGTGGGGCGGG - Intronic
1105915660 13:24913577-24913599 TGGTGGGTGAGGTGTTAGTAGGG - Intronic
1107314248 13:39114144-39114166 TATTGGGGGAGGGGAGGGGAGGG - Intergenic
1107804980 13:44145267-44145289 TAGTGGGAAAGGAGTGAGGATGG + Intronic
1107931391 13:45310537-45310559 TAGTGGGTGCTAGGTGGGGAGGG - Intergenic
1109336136 13:60997158-60997180 GAGTGGGTTAGGGGAGAGGTGGG - Intergenic
1110670831 13:78175494-78175516 TAGTCAATGAAGGGTGAGGATGG - Intergenic
1110784181 13:79503689-79503711 TTGTGGCTGAGGTGTTAGGATGG + Intronic
1110806366 13:79758774-79758796 TAGTGGGTGGGGTATGTGGATGG - Intergenic
1110949844 13:81472063-81472085 GAGTGGGTGGGAGGTGGGGATGG + Intergenic
1111047229 13:82829588-82829610 AAATAGGTGAAGGGTGAGGAAGG + Intergenic
1111227762 13:85296429-85296451 TTGAGGTTGAGGGGTGATGAAGG + Intergenic
1111478234 13:88783315-88783337 CAGTGGGTGAAGTGTGAGGAGGG - Intergenic
1112527699 13:100168024-100168046 GAGGGGGTCAGTGGTGAGGAAGG - Intronic
1113374196 13:109748985-109749007 TAATGGGTGAGTGGGGAGGAAGG + Intergenic
1113453880 13:110433381-110433403 GACTTGGTCAGGGGTGAGGAGGG - Intronic
1113606268 13:111609755-111609777 TCGTGGGTGAGGTGTCAGGAGGG + Intronic
1113804833 13:113106690-113106712 TAGGGGGTGTGGCGTGAGGATGG + Intronic
1113966592 13:114156238-114156260 TGGGGGGGGAGGGGTGGGGAAGG + Intergenic
1113966636 13:114156334-114156356 TGGGGGGGGAGGGGTGGGGAAGG + Intergenic
1113987133 13:114326999-114327021 CGGTGGGTGGGGGGTGGGGATGG - Exonic
1114492389 14:23111518-23111540 TAGTTGGTGAGGGTAGAAGAGGG - Intergenic
1114814241 14:25937747-25937769 TAGTGGGTGTGGGAAGTGGAAGG + Intergenic
1115197019 14:30812324-30812346 AGGTGGGGGAGGGGTGGGGAAGG + Intergenic
1115409675 14:33060020-33060042 TAGAGGCTGAGGTGGGAGGATGG - Intronic
1115764910 14:36613714-36613736 TGGAGGGTGATGGGTGAGAAAGG + Intergenic
1116126507 14:40795407-40795429 TAGTGATTAAGGGGTGAGGTTGG + Intergenic
1116142198 14:41011773-41011795 TAGAGTGGGAGGGGTGATGAAGG - Intergenic
1116361239 14:44000991-44001013 TAGTGGGAGAGAGGTGGGAATGG + Intergenic
1116458363 14:45144306-45144328 TAGTGGGCGAGGGGGGTGGAGGG - Intronic
1118312381 14:64703675-64703697 TGGGGGGCAAGGGGTGAGGATGG - Intergenic
1118712667 14:68535381-68535403 TGGGGGGTGAGGGGTGGGGGTGG - Intronic
1118778989 14:68993704-68993726 GAGTGGGTGGTGGGTGGGGAGGG - Intergenic
1119020867 14:71112617-71112639 TGGGGGGTGAGGGGTGAGGCAGG - Exonic
1119131793 14:72179645-72179667 CAGGGGGTGGGGGGTGGGGAAGG - Intronic
1119219646 14:72895336-72895358 TAGTGGGGGAGGGGTGGCAAGGG + Intergenic
1119421049 14:74508261-74508283 GTGGGGGTGAGGGGTGAGGTGGG + Intronic
1120124772 14:80728370-80728392 GGATGGGAGAGGGGTGAGGATGG + Intronic
1120599554 14:86485184-86485206 GAGGTGGTGAGGGGTGAGGAGGG + Intergenic
1120762515 14:88298403-88298425 CAGTAGGTGATGGATGAGGAGGG - Intronic
1121567747 14:94923490-94923512 GAGGGGGGGAGGGGGGAGGAGGG - Intergenic
1121623422 14:95366530-95366552 GGGAGGGTGAGGGGTGAGGAAGG + Intergenic
1121739853 14:96243692-96243714 GAGTGGGTTGGGGGTAAGGAGGG - Exonic
1122438182 14:101712926-101712948 CAGTGGGTGGGGGGAGATGACGG - Intergenic
1122438229 14:101713094-101713116 CAGTGGGTGGGGGGAGATGACGG - Intergenic
1122438327 14:101713462-101713484 CAGTGGGTGGGGGGAGATGACGG - Intergenic
1123682906 15:22775565-22775587 TGGTAGGTGAGGGCTGAGTATGG + Intronic
1124043918 15:26129962-26129984 TAGAGGCTGAGGTGGGAGGATGG + Intergenic
1124056350 15:26243952-26243974 TGGGGGGTGGGGGGTGGGGATGG + Intergenic
1125490790 15:40147115-40147137 TGGAGGGTCAGGGGTGAGGAAGG + Intergenic
1125733181 15:41905772-41905794 GAGAGGGTGAGGTGGGAGGATGG - Intronic
1125734173 15:41912026-41912048 CAGTGGGTGAAGGGTGTGGCAGG - Intronic
1125873386 15:43122916-43122938 AAGTGGGTGGGAGGTGAGTAGGG - Intronic
1126679290 15:51188126-51188148 TAGTGGGGCAGGGGTGACGCAGG - Intergenic
1127469826 15:59280981-59281003 TAGTGGGTTGGAGGTGAGGATGG - Intronic
1127885461 15:63195783-63195805 AAGAGGGTTGGGGGTGAGGATGG + Intronic
1127961917 15:63896359-63896381 CAGATGGGGAGGGGTGAGGAGGG - Intergenic
1128065672 15:64763049-64763071 TAGTGGGTAGGGGGTGGGGGTGG + Intronic
1128303021 15:66579140-66579162 TAGAGGCTGAGGTGGGAGGATGG - Intergenic
1128370357 15:67035449-67035471 TCCTGGGTGTGGGGTGGGGAGGG + Intergenic
1128463048 15:67885593-67885615 TAGAGGGTGAGAGGTGAACAAGG - Intergenic
1129007375 15:72385118-72385140 GAATGGGTGGGGGGTGGGGAGGG - Intergenic
1129161555 15:73750954-73750976 AGGTAAGTGAGGGGTGAGGAGGG - Exonic
1130300473 15:82676644-82676666 TTGTGGGAGAGGAGTGAAGATGG + Intronic
1130322667 15:82853841-82853863 TGGTGCTTGAGGCGTGAGGAGGG - Intronic
1130468289 15:84203721-84203743 CAGTGTGTGTGGGGTGGGGAGGG + Intergenic
1130485460 15:84396021-84396043 CAGTGTGTGTGGGGTGGGGAGGG - Intergenic
1130495977 15:84469821-84469843 CAGTGTGTGTGGGGTGGGGAGGG - Intergenic
1130528218 15:84725154-84725176 TCCAGGGTGAGGGGTGAGGCTGG - Intergenic
1130590582 15:85208319-85208341 CAGTGTGTGTGGGGTGGGGAGGG + Intergenic
1131290329 15:91101230-91101252 TGGCAGGTGAGGGGTAAGGAGGG + Intronic
1131353953 15:91726961-91726983 TTGTGGGTGGGTGGTGGGGAGGG - Intergenic
1131371082 15:91882487-91882509 TAGTGGGGGTGGGGTGGGGGTGG - Intronic
1132482098 16:171905-171927 GAGGGGATGTGGGGTGAGGAAGG - Intergenic
1132697852 16:1209902-1209924 CAGCGGGTGAGGAGTGAGGATGG + Intronic
1132726769 16:1342286-1342308 GAGTGGGTGTGGGGTGGGGCTGG + Intronic
1132803510 16:1765421-1765443 TAGAGGGTGACGGGTGGGCACGG + Intronic
1132862059 16:2076610-2076632 GAGTCGGTGTGGGGTGGGGAAGG + Intronic
1134140488 16:11714144-11714166 TAGGGGCTGAGGTGGGAGGATGG - Intronic
1134197534 16:12170458-12170480 CAGTGGGGGAGGCGTGTGGATGG + Intronic
1135114288 16:19712328-19712350 TAGAGGGGGAGGGGAGTGGAGGG - Intronic
1135628168 16:24014263-24014285 CAGGGGGAGAGGGGTGGGGAGGG + Intronic
1136063936 16:27746385-27746407 TCGTGCCTGAGGGGAGAGGATGG + Intronic
1136344370 16:29665417-29665439 TTGTGGGTGCTGGGTGAGGATGG - Exonic
1136393758 16:29981821-29981843 GGGTGGGAGAGGGGTGGGGAAGG - Intronic
1136481239 16:30543270-30543292 TGGTGGGTGTAGGGTAAGGATGG + Intronic
1136481739 16:30546320-30546342 GAGCGGGTGAGGGGTGGAGACGG + Intronic
1137652922 16:50135854-50135876 TAGTGGGGGAGGTGGGAGGTAGG - Intergenic
1137719150 16:50617614-50617636 TCGTGGCTGTGGTGTGAGGAGGG + Intronic
1137817240 16:51410133-51410155 CAGTGGGTGAGGGGTCTGAAGGG - Intergenic
1138217163 16:55214493-55214515 AAGGGGAGGAGGGGTGAGGAGGG + Intergenic
1138249279 16:55489892-55489914 AAGTGGGTGAGGTCTCAGGAAGG - Intronic
1138249639 16:55491976-55491998 TTGGGGGTGGAGGGTGAGGAGGG + Intronic
1138446978 16:57070677-57070699 AAGTGGGTGAGTGGTGGGGTTGG + Intronic
1138446988 16:57070714-57070736 AAGTGGGTGAGTGGTGGGGTTGG + Intronic
1138453043 16:57105187-57105209 TAGTGGAAGTGGGGAGAGGACGG + Intronic
1138457871 16:57131724-57131746 GAGAGGGTGAGGGGCCAGGAGGG - Intronic
1138594341 16:58021865-58021887 ATGTGGGTGAGGGATGAGGGTGG - Intergenic
1139521432 16:67484687-67484709 TAGAGGCTGAGGTGGGAGGATGG + Intergenic
1139696794 16:68680816-68680838 CAGTGGGTGAGGGGTGGTCAAGG + Intronic
1139759318 16:69171670-69171692 CTGTGGGAGAGGGGAGAGGAGGG + Intronic
1140003643 16:71052743-71052765 TGGTGGCTGAGGTGGGAGGATGG + Intronic
1140168517 16:72579625-72579647 AAGTGGCTGAGGTGGGAGGATGG - Intergenic
1140207784 16:72947712-72947734 GGGTGGGGAAGGGGTGAGGAAGG + Intronic
1140280200 16:73546818-73546840 TGGGGGGTGAGGGGGGAGGGAGG + Intergenic
1140359515 16:74332523-74332545 CAGTGGGGGAGGGGAGGGGAGGG + Intergenic
1141524782 16:84604267-84604289 CAGGGGGTGAGGGCTGTGGAGGG - Intronic
1141558128 16:84849334-84849356 TGGTGGGTGAGGGGAGGGGCTGG + Intronic
1141634563 16:85307136-85307158 TAGTGGGGGTGGGGTGGGGTGGG + Intergenic
1141752796 16:85970363-85970385 AAATGGGTGAGGGGTGTGGAAGG - Intergenic
1141809152 16:86362893-86362915 TGGTGGGGGTGGGGTGAGGTCGG + Intergenic
1141855781 16:86680841-86680863 TAGAGGGAGAGGGGACAGGACGG + Intergenic
1141896124 16:86959660-86959682 GGCTGGGTGAGGGGTGGGGATGG - Intergenic
1142326446 16:89418474-89418496 CAGTGGGTCATGGGAGAGGAAGG - Intronic
1142478637 17:204634-204656 GGGTGGTGGAGGGGTGAGGATGG - Intergenic
1142548169 17:720330-720352 TAGTAGGCGATGGGGGAGGATGG + Intronic
1142669765 17:1482745-1482767 TAGTGTGGGAGGGGAGGGGAGGG - Intronic
1143521611 17:7447351-7447373 TAATGGGGGAGGGATGGGGAGGG - Intronic
1144695670 17:17302443-17302465 GAGTGGGAGGAGGGTGAGGATGG + Intergenic
1144739780 17:17575447-17575469 GAGGTGGTGAAGGGTGAGGAGGG - Intronic
1145793780 17:27644079-27644101 TCGTGGGTTGGGGGTGAGGCAGG - Intronic
1145812442 17:27772611-27772633 TAGTGGGTGAGGGGAGGAAAAGG - Intronic
1146589550 17:34116845-34116867 AAGTGTGTGTGGGGGGAGGAGGG + Intronic
1147315922 17:39620188-39620210 TAGTGGGAGATGGGTGGGGATGG + Intergenic
1147574734 17:41592608-41592630 TAGGGGGTCGGGGGTGGGGACGG + Intergenic
1147588565 17:41666878-41666900 GAGGGGGTGGGGGGTGAGGAAGG - Intergenic
1147847055 17:43411831-43411853 CAGGGGGTGGGGGGTGTGGATGG + Intergenic
1148105121 17:45114840-45114862 TAGAGGGTGATGGGTCAGGCTGG - Intronic
1148152621 17:45405404-45405426 CAGAGGGTGAGGGGTGGGGCAGG - Intronic
1148492454 17:48032146-48032168 TTGTGGATGGCGGGTGAGGAGGG - Exonic
1148812113 17:50300021-50300043 TACTGGGTGAGGGTGGAGGGAGG - Intergenic
1148892625 17:50819133-50819155 TAGGGGGAGAGTGGTCAGGAAGG + Intergenic
1149176305 17:53876082-53876104 TAGGGGGTGCAGGGGGAGGAAGG - Intergenic
1149274977 17:55023702-55023724 GAATGGGTGAGAGGAGAGGAGGG + Intronic
1149497784 17:57131206-57131228 TACTGGGTGCGGGGTGGGGGTGG - Intergenic
1149673942 17:58441938-58441960 GTGTGAGTGAGGGGGGAGGATGG + Intronic
1151174295 17:72274394-72274416 TGGTGGGGGCAGGGTGAGGAGGG + Intergenic
1151539272 17:74756972-74756994 AGGAGGGTGAGGGATGAGGAAGG + Intronic
1151623693 17:75263114-75263136 GAGGGGGTGGGGGGTGAGGTGGG - Intronic
1152563445 17:81089854-81089876 CAGTGGGTGTGAGGTGAGGGTGG + Intronic
1152595372 17:81235331-81235353 TGGTGGGTGTGCAGTGAGGATGG - Intronic
1152681129 17:81668595-81668617 TAGTGAGATAGAGGTGAGGAAGG + Intronic
1152710509 17:81868689-81868711 GGGTGGGGGAGGGCTGAGGAGGG + Exonic
1152728141 17:81957763-81957785 CTGGAGGTGAGGGGTGAGGACGG - Intronic
1152825598 17:82462746-82462768 AAGAATGTGAGGGGTGAGGAGGG + Intronic
1154105962 18:11523347-11523369 GAGTGAGTGAGAAGTGAGGAGGG - Intergenic
1154966901 18:21367455-21367477 TAGCGGGTGGGGAGTGAGGGAGG + Intronic
1157231428 18:45920110-45920132 GAGTGGGTAAGGGGAGAGGAAGG - Intronic
1157255564 18:46135791-46135813 GAGTGAGTGATGTGTGAGGACGG - Intergenic
1157531926 18:48428670-48428692 AAGTGGGTGTGGGGAGAGGGAGG - Intergenic
1157899934 18:51505068-51505090 TGATGGGTGAGGAGTGAAGAGGG + Intergenic
1157913799 18:51644563-51644585 GAGTGTGTCAGGGGTGAGGCTGG + Intergenic
1158228863 18:55231088-55231110 TTGGGGGTGAGGGCAGAGGAGGG - Intronic
1158550512 18:58431646-58431668 TAGTGGTTGGGAGGTGGGGAGGG - Intergenic
1158720329 18:59918775-59918797 TACTGGCTGAGGAGTGAGGAGGG + Intergenic
1159213601 18:65362340-65362362 TTGTGGGGGAGGGGGGAGGGAGG + Intergenic
1159367229 18:67484099-67484121 AAGGGGGTGAGGGATGAGTAAGG - Intergenic
1159983397 18:74813462-74813484 TGGTGGGTGTGGGGTGAAGGGGG - Intronic
1159994897 18:74955071-74955093 CAGTGTTTGAGGGGAGAGGAAGG + Intronic
1160245048 18:77151585-77151607 TAGTCTGTGAGAGGTTAGGAGGG + Intergenic
1160405065 18:78639723-78639745 GAGCGGGTGAGTGGTGAGGCCGG - Intergenic
1161631186 19:5356594-5356616 TGGTGGCTGAGGGGTGGGGTGGG + Intergenic
1161716734 19:5880525-5880547 TGGTCGGTGGGGGGTGGGGAAGG - Intronic
1162030556 19:7915466-7915488 AAGTGGGTGTGGTGTGCGGATGG + Intergenic
1162034954 19:7933701-7933723 TTGAGGGTGAGAGGTGAGGGCGG - Intronic
1162147455 19:8621429-8621451 TGGTGAGTGAGCGGGGAGGAAGG + Intergenic
1162836027 19:13318547-13318569 TAGACAGTGAGAGGTGAGGACGG + Intronic
1162955076 19:14092882-14092904 AAGTGGGAGAGGGGGCAGGAGGG + Exonic
1163008719 19:14411750-14411772 TAGGGAGTGAGGGGTGGGGAAGG - Intronic
1163020482 19:14478569-14478591 TATTGGGGGAGGGGTCAGAACGG + Intronic
1163085683 19:14978169-14978191 TACAGGGTGAGGGGTGAGGGTGG + Intronic
1163145626 19:15377861-15377883 TAGTGGGCGGGGGGTGTGGAGGG - Intronic
1163236680 19:16034091-16034113 AGGTGGGGGAGGGGTGAGGGGGG + Intergenic
1163551451 19:17968062-17968084 TATTGGGGGAGGGGAGGGGAAGG + Intronic
1163755520 19:19104326-19104348 TGGGTGGTGAGGGGTGAGGGAGG + Intronic
1163827871 19:19533630-19533652 AAGAGGAGGAGGGGTGAGGAGGG - Intronic
1163883242 19:19945345-19945367 GAGTGGGTAAGGGGTGGTGATGG - Intergenic
1164305954 19:24003968-24003990 TGGCGGGTGGGGGGTGGGGAAGG - Intergenic
1164394300 19:27850377-27850399 GAAGGGGTGTGGGGTGAGGAGGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164649483 19:29881694-29881716 CAGTGGGTGAGGGATGGGCAGGG + Intergenic
1164669125 19:30063045-30063067 AAGAGGGTGGGGGGTGAGGCTGG + Intergenic
1164726738 19:30470568-30470590 TAGTGGGGGAGGTGTGGGGTCGG - Intronic
1164998715 19:32743352-32743374 GAGTGGGGGAGGGGAGGGGAGGG - Intronic
1165591558 19:36973534-36973556 GAGTGGGTGTGGTGTGAGGCTGG + Intronic
1165756485 19:38296172-38296194 TGGGGGGAGAGGGGTGGGGAGGG + Intronic
1166054649 19:40281072-40281094 GCCTGGGTGAGAGGTGAGGATGG - Intronic
1166234127 19:41443342-41443364 TGGTGAGTGAGGGGTTTGGAAGG + Exonic
1166294120 19:41880737-41880759 AAGTGAGTGAAGGGTGGGGATGG + Exonic
1166301065 19:41912591-41912613 AAGTGAGTGAGGGGTGAGGACGG - Intronic
1166827864 19:45620768-45620790 AATTGGGTCAGGGGTAAGGAAGG + Intronic
1167056305 19:47113139-47113161 TAGAGGCTGAGGCGGGAGGAAGG + Intronic
1167240186 19:48338883-48338905 CTGAGGGTGAGGGGTGAGCAGGG + Intronic
1167374685 19:49104371-49104393 TAGGGGGTGGCGGGTGAGGGTGG + Intronic
1167566694 19:50261445-50261467 GGGTGGGAGAGGGGTGATGACGG - Intronic
1167787013 19:51645376-51645398 CAGGGGCTGAGGGGTGAGGGAGG + Intronic
1168371605 19:55839123-55839145 CCGTGGGTGAGGGGTGGGAAAGG - Intronic
925101447 2:1249958-1249980 TGGAGAGTGAGGGCTGAGGAGGG + Intronic
925348747 2:3187540-3187562 TGGTGGGTGGGGAGTGGGGAGGG - Intergenic
925348848 2:3187799-3187821 AGGTGGGTGAGGAGTGGGGAGGG - Intergenic
925348883 2:3187887-3187909 AGGTGGGTGAGGAGTGGGGAGGG - Intergenic
926145881 2:10396951-10396973 GGGTGGGTGAGGACTGAGGATGG + Intronic
926152859 2:10434510-10434532 TAGTGTGTGGGGGATGGGGAGGG + Intergenic
926174695 2:10580351-10580373 GAGCGGGGGAGGGGAGAGGAGGG - Intronic
926477735 2:13348483-13348505 CAGAGGGTGGAGGGTGAGGAGGG - Intergenic
927836049 2:26400162-26400184 TTGTGGTTAAGGGGTGAGGCTGG + Intergenic
927852755 2:26510512-26510534 ACGGGGGTGAGGGATGAGGAGGG - Intronic
928018377 2:27680548-27680570 GAGTGAGTGAGGTGGGAGGATGG + Intronic
928170384 2:28999481-28999503 GGGTGGGTGAGGGGTGGGCAGGG - Intronic
928180488 2:29065157-29065179 TTGTGGGAGAGGGCTGGGGAGGG - Intronic
928422557 2:31150208-31150230 TAGTCAGTGAGGGGTGGGGTTGG - Intronic
928858964 2:35832800-35832822 TAATTGGTTAAGGGTGAGGATGG + Intergenic
929055419 2:37872523-37872545 TAGTGGGGGAAGGGTGAGGCTGG + Intergenic
929230641 2:39556496-39556518 AAGAGGGTGAGGTGGGAGGATGG - Intergenic
929536611 2:42788037-42788059 TAGTGGCTGAGGGGTAGGCATGG - Intronic
929968698 2:46554638-46554660 GAGTGGCTGAAGGGAGAGGAAGG + Intronic
930136154 2:47905807-47905829 GAGTGGGAGAGGGGGGAGGAAGG + Intergenic
930372848 2:50526014-50526036 AAATGGGTGGGAGGTGAGGAGGG - Intronic
930624423 2:53680848-53680870 TGGTTGGTGAGAGGTGGGGATGG - Intronic
930624429 2:53680868-53680890 TGGGGGGTGAGAGGTGGGGATGG - Intronic
930695947 2:54411778-54411800 TATTGGGTCAGGGGTGAGTAAGG + Intergenic
931123543 2:59248114-59248136 TAGTGGGTGAAGGGTGCAGTTGG - Intergenic
932215902 2:69965838-69965860 TACTGGGTGAGGAGTGTGGCAGG - Intergenic
932312373 2:70754045-70754067 TTATGGCTGAGGGGTGAGGCAGG + Intronic
932476443 2:72009307-72009329 TAGTGGCTGGGGTGGGAGGAGGG - Intergenic
933695291 2:85213016-85213038 AAGTGGGTGAGGTGTGGGGTGGG + Intronic
934536693 2:95140128-95140150 CAGTGGGTGAGGGGAGCTGAGGG + Intronic
934612235 2:95749023-95749045 TAGTGGGGGTGAGGTGGGGATGG + Intergenic
934841917 2:97630433-97630455 TAGTGGGGGTGAGGTGGGGATGG - Intergenic
934901463 2:98163116-98163138 TGTGGGGTGAGGGGTGGGGAGGG + Intronic
935444523 2:103142021-103142043 AAGTGGGTGGGGGATGAGGATGG - Intergenic
935864173 2:107367267-107367289 TAATGAGAGTGGGGTGAGGAAGG + Intergenic
935984539 2:108660102-108660124 GAGTGGGTGAGGTGTGTGGGGGG - Intronic
936136976 2:109903750-109903772 GAGTGGGTGAGGTGTGTGGGGGG - Intergenic
936207721 2:110467735-110467757 GAGTGGGTGAGGTGTGTGGGGGG + Intronic
936462662 2:112724026-112724048 TGGTGGGTGAGGGCAGAGGCAGG + Intronic
936888830 2:117344993-117345015 TAGAGGCTGAGGTGGGAGGATGG + Intergenic
936960035 2:118063249-118063271 GAGTGGGAGGAGGGTGAGGATGG - Intergenic
937075809 2:119105670-119105692 GAATGAGTGAGGAGTGAGGAGGG - Intergenic
937106135 2:119314996-119315018 TGTGTGGTGAGGGGTGAGGAAGG + Intronic
937124498 2:119464813-119464835 TTTTGGGGGAGGGGTGAGGACGG + Intronic
938539263 2:132273127-132273149 AAGGGGGTGAGGGGTGGGGACGG - Intergenic
938629365 2:133149437-133149459 TGGTGGGGGTGGGGTGGGGATGG - Intronic
938675544 2:133629980-133630002 GAGGGGGTGGGAGGTGAGGAGGG + Intergenic
938743208 2:134252336-134252358 TAGTGGGAGAGGGGTGTGATGGG + Intronic
938891725 2:135712366-135712388 AAGTGGCTGAGGTGGGAGGATGG - Intronic
938924229 2:136024571-136024593 TAGAGGCTGAGGCGGGAGGATGG - Intergenic
940000575 2:148963063-148963085 TTGTGGGTGAGGTGTTAAGAGGG + Intronic
941199102 2:162487468-162487490 TGGGGGGTGAGTGGGGAGGAGGG + Intronic
941900929 2:170677358-170677380 GGGTGGGGGAGGGGTCAGGAAGG - Intergenic
942452016 2:176114346-176114368 TTGGGGGTGGGGGTTGAGGATGG - Intronic
943468768 2:188265432-188265454 TGAGGGGTGAGGGGTGAGGGTGG + Intergenic
943694434 2:190909464-190909486 AAGTGGGGGAGGGGGGAGAAGGG - Intronic
943818667 2:192290180-192290202 AAATGGGTGCGGGGTGGGGACGG + Intergenic
944128162 2:196317598-196317620 TTATGGGTGAGGGATGAGGCAGG - Intronic
944300522 2:198119632-198119654 TGGAGGGTGAGGGGTATGGAGGG - Intronic
944923329 2:204437798-204437820 GAGTGGGTGGAGGGCGAGGAAGG + Intergenic
945261525 2:207848223-207848245 TGGTGGGGAAGGGGTGGGGATGG - Intronic
945268791 2:207917975-207917997 TAGGGGGTGAGGGGAGAAGAGGG + Intronic
945787412 2:214259531-214259553 GTGTGGGGGAGGGGTGAGGGGGG - Intronic
945993177 2:216413143-216413165 TGGTGGGGGAGGGGGGAGGGGGG + Intronic
946563894 2:220941995-220942017 TGGTGGGTGAGGGTAGAGGATGG + Intergenic
947216561 2:227755283-227755305 GAGTGGGGGAGGGGTGGGGGCGG - Intergenic
947643321 2:231719662-231719684 TGGAGGCTGAGGGGGGAGGATGG - Intergenic
948428920 2:237906289-237906311 TAGTAGATGAGGCATGAGGAGGG - Intronic
948893566 2:240918215-240918237 TGGGGGGTGGGGGCTGAGGATGG - Intergenic
949001903 2:241619722-241619744 GAGTCGGTGAGGGGTGAGTGAGG + Intronic
949001920 2:241619830-241619852 TCGTGAGTGAGGGGTGAGTGAGG + Intronic
949001963 2:241620042-241620064 GAGTGAGTGAGGGGTGAGTGAGG + Intronic
949002044 2:241620488-241620510 GAGTGAGTGAGGGGTGAGTGAGG + Intronic
949043263 2:241858999-241859021 TGGGGGAGGAGGGGTGAGGAGGG + Intergenic
1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG + Intronic
1169217093 20:3800231-3800253 GGGTGGGTGATGGGTGCGGAGGG + Intronic
1169391170 20:5192340-5192362 TGGTGGGGGTGGGGTGGGGAAGG + Exonic
1169506053 20:6213029-6213051 CAATGGGTGAGGAGCGAGGAAGG + Intergenic
1169709709 20:8548022-8548044 GAGTGTGTGGGTGGTGAGGAAGG - Intronic
1170041627 20:12045326-12045348 GAGGAGGGGAGGGGTGAGGAGGG - Intergenic
1170041634 20:12045341-12045363 GAGGAGGGGAGGGGTGAGGAGGG - Intergenic
1170218370 20:13915902-13915924 AGGTGGGTGATGGGGGAGGAAGG + Intronic
1170747281 20:19111459-19111481 CAGTGGGTGGGGAGAGAGGAAGG + Intergenic
1170968116 20:21094464-21094486 TAGGAGTTGAGGGGTGAGCATGG + Intergenic
1171089137 20:22267674-22267696 TGGTGGGTGAGGGGCCTGGAGGG - Intergenic
1171227144 20:23451334-23451356 TGGTGGGTGAGGGTGGATGAGGG - Intronic
1171769397 20:29310954-29310976 GAGGGGGTGTGGGGTGGGGACGG - Intergenic
1171868204 20:30505980-30506002 AAGGGGGTGCGGGGTGGGGACGG - Intergenic
1172009647 20:31839012-31839034 GAGTGAGTGAGGGGGAAGGAAGG + Intergenic
1172446839 20:34997650-34997672 GGGTGGGTATGGGGTGAGGAAGG - Intronic
1173251109 20:41364697-41364719 CAGAAGGTGAGGGGAGAGGAGGG - Intronic
1173288989 20:41697877-41697899 TAGTGGGCAAGGGAAGAGGAGGG - Intergenic
1173471082 20:43324126-43324148 TGGGGGGTGGGGGGTGGGGAAGG - Intergenic
1173608019 20:44345688-44345710 TACTGGGGGAGGGGTGAGGCGGG + Intronic
1173676499 20:44840335-44840357 TAGAGGTTGAGGTGGGAGGATGG - Intergenic
1174560564 20:51428034-51428056 TAGTGGGTGAGAGGGAAGGAGGG + Intronic
1175160108 20:57002161-57002183 TGGTGGGTGTGGGGTGGGGAGGG - Intergenic
1175262097 20:57681165-57681187 TGGTGGGGCAGGGGTGAGGCAGG + Intronic
1175576034 20:60061402-60061424 TAGTGGGTAGGGGAAGAGGAGGG + Intronic
1175785920 20:61711800-61711822 TATAGGGTGGAGGGTGAGGACGG + Intronic
1175834196 20:61982887-61982909 TTGTGGGGGACGGGTGGGGAGGG - Intronic
1175907586 20:62388572-62388594 CAGTGGGTGACGGGTGGGGTAGG + Intergenic
1176172430 20:63702001-63702023 TAGTGGGTGACGGGGGGGGGGGG - Intronic
1176265393 20:64206546-64206568 TGCTGGGTGAGTGGTGGGGATGG - Intronic
1176390205 21:6159308-6159330 CAGTGGAGGAGGGGTGAGGTTGG - Intergenic
1176551858 21:8226576-8226598 GAGGGGGTGCGGGGTGGGGACGG + Intergenic
1176570767 21:8409575-8409597 GAGGGGGTGCGGGGTGGGGACGG + Intergenic
1176578676 21:8453722-8453744 GAGGGGGTGCGGGGTGGGGACGG + Intergenic
1177203206 21:17980740-17980762 GAGTGGATGAGGTGTGAGGGAGG - Intronic
1177412579 21:20749349-20749371 TGGTGGATGAGGGGTGGGGAGGG + Intergenic
1177553265 21:22654045-22654067 AAGAGGCTGAGGTGTGAGGATGG + Intergenic
1177739527 21:25136785-25136807 AAGTGGCTGGGGGGTAAGGAGGG - Intergenic
1178342786 21:31800455-31800477 AACTGGGAGAGGGGTGAGGATGG - Intergenic
1178920850 21:36737291-36737313 TGGTGGGTGAGGCGTGGGGTGGG - Intronic
1179117268 21:38505329-38505351 GAGGGGGCGAGGGATGAGGAGGG - Intronic
1179350975 21:40610585-40610607 TATTGGGGGAGGGGAGGGGATGG - Intronic
1179452190 21:41474565-41474587 GAGGGGGTGAGGGGTGAGTGAGG + Intronic
1179452209 21:41474612-41474634 GAGGGGGTGAGGGGTGAGTGAGG + Intronic
1179452220 21:41474639-41474661 GAGGGGGTGAGGGGTGAGTGAGG + Intronic
1179452340 21:41474983-41475005 GAGGGGGTGAGGGGTGAGTGAGG + Intronic
1179452568 21:41475739-41475761 GAGGGGGTGAGGGGTGAGTGAGG + Intronic
1179538541 21:42068307-42068329 GAGTGAGAGAGGGGTGAGGCTGG + Intronic
1179548081 21:42125517-42125539 GAGGGGCTGAAGGGTGAGGAAGG - Intronic
1179615817 21:42582530-42582552 TGGTGGCTATGGGGTGAGGAAGG - Intergenic
1179723516 21:43329317-43329339 GGGTGGGTGTGGGGTGATGAGGG + Intergenic
1179733261 21:43378932-43378954 CAGTGGAGGAGGGGTGAGGTTGG + Intergenic
1179879165 21:44286323-44286345 TTGGGGGTGAGGTGTGGGGACGG - Intronic
1179926036 21:44534320-44534342 TGGTGTGTGAGGGGTGGGGCTGG + Intronic
1179926056 21:44534376-44534398 TGGTGTGTGAGGGGTGGGGCTGG + Intronic
1179926085 21:44534456-44534478 TGGTGTGTGAGGGGTGGGGCTGG + Intronic
1180024952 21:45155795-45155817 TAATGGGTAATGGGTGATGATGG - Intronic
1180025066 21:45156227-45156249 TGATGGGTGATGGGTGATGATGG - Intronic
1180025078 21:45156275-45156297 TGATGGGTGATGGGTGATGATGG - Intronic
1180025090 21:45156319-45156341 TGATGGGTGATGGGTGATGATGG - Intronic
1180025101 21:45156363-45156385 TGATGGGTGATGGGTGATGATGG - Intronic
1180025141 21:45156519-45156541 TGATGGGTGATGGGTGATGATGG - Intronic
1180589881 22:16928363-16928385 TGGTGGGTGAGGGGAGAAGCTGG + Intergenic
1180607360 22:17068800-17068822 CAGTGGGTGAAGGGGGAGAAGGG - Intergenic
1181065103 22:20301953-20301975 AAGTGGCTGAGGTGGGAGGATGG - Intergenic
1181109915 22:20596070-20596092 GAGGGGGTGAGTGTTGAGGAGGG + Intergenic
1181273134 22:21672519-21672541 GAATGGGTGTGGGGAGAGGAGGG - Intronic
1181305509 22:21914990-21915012 TAGAGGGTGAGTGGTGGGGGCGG + Intergenic
1181387872 22:22558281-22558303 GGGTGGGGGAGGGGTGAGGATGG + Intronic
1181387904 22:22558354-22558376 AAGGGGGGGAGGGGTGGGGATGG + Intronic
1181387980 22:22558566-22558588 TGGGGGGTGAGGGGTGGGGATGG + Intronic
1182351947 22:29704345-29704367 TGGTGGGGGAGGGGAGGGGAGGG - Intergenic
1182351967 22:29704387-29704409 TGGTGGGGGAGGGGAGGGGAGGG - Intergenic
1183263324 22:36810418-36810440 TAGGGGGTTGGGAGTGAGGAAGG + Intronic
1183273216 22:36874868-36874890 AAGAGGATGAGGGGTGAGGAAGG - Intronic
1183718725 22:39549790-39549812 TGGTGGGTGGGGAGTAAGGATGG - Intergenic
1184029577 22:41884027-41884049 TAGTGGGTGGGAGGCCAGGAAGG - Intronic
1184045401 22:41969729-41969751 TGGTGGGGGTGGGGTGGGGAAGG + Intergenic
1184321234 22:43743731-43743753 TGGAGGGTGAGGGGTGAAGGAGG - Intronic
1184377798 22:44125467-44125489 TGGTGGGTGGGGGTTGGGGAAGG + Intronic
1184383615 22:44161824-44161846 CAATGGGGGAGGAGTGAGGACGG - Intronic
1184555103 22:45228846-45228868 TGGTGGTTGGGGGGTGAAGAGGG - Intronic
1184582467 22:45426750-45426772 TAGGGGCTGAGGGGGAAGGAAGG + Intronic
1184691655 22:46120003-46120025 AAGTGGGTGAGGGGAGCGGCTGG - Intergenic
1184735294 22:46394432-46394454 CTGTGGGTGGGGGGTGAGGTTGG - Intronic
1184814082 22:46857333-46857355 TTTTGGGTCAGGGCTGAGGAGGG - Intronic
1185302199 22:50087716-50087738 CAGTGGGCAAGTGGTGAGGAGGG + Intergenic
1185391054 22:50562102-50562124 GAGCGGGGGAGGGGTGAGGCGGG + Intronic
1185391136 22:50562329-50562351 TGAGGGGTGAGGGGTGAGGCGGG + Intronic
1185391178 22:50562435-50562457 TGAGGGGTGAGGGGTGAGGCGGG + Intronic
1185391215 22:50562529-50562551 TGAGGGGTGAGGGGTGAGGCGGG + Intronic
1185391224 22:50562553-50562575 TGAGGGGTGAGGGGTGAGGCGGG + Intronic
1203256879 22_KI270733v1_random:143498-143520 GAGGGGGTGCGGGGTGGGGACGG + Intergenic
949357936 3:3201668-3201690 GAATGGGTGAGGAGTGAGGCAGG - Intergenic
949710192 3:6862724-6862746 TAGTGGGTGAGGGGGGCGGGGGG - Intronic
949863991 3:8532392-8532414 GAGTGGGTGAGGGTGGGGGATGG + Intronic
950083362 3:10239356-10239378 TAGTGAGGGAGGGGCCAGGATGG - Intronic
950113975 3:10438652-10438674 TAATCGTTGTGGGGTGAGGAGGG + Intronic
950122119 3:10488816-10488838 TGGGGGGTGAGGTGAGAGGAAGG - Intronic
950451363 3:13067523-13067545 CAGTGGGGAAGGGGTGGGGAGGG + Intronic
950944353 3:16929184-16929206 TCGTGGGAGAGAGGGGAGGAGGG + Intronic
951436550 3:22671351-22671373 TTGTTGGTGGGGGGTGGGGAGGG + Intergenic
951859659 3:27237654-27237676 GGGTGGGAGTGGGGTGAGGAAGG + Intronic
952427853 3:33193649-33193671 GAGTGAGTGAGGGGAGATGAGGG + Intronic
952433655 3:33250041-33250063 TGTGGGGTGGGGGGTGAGGAGGG - Intergenic
952621000 3:35342389-35342411 AAGTGGGGGAGGGGGGAAGAAGG + Intergenic
953383561 3:42492193-42492215 TAGGGGAGGAGGGATGAGGAAGG - Intronic
953470753 3:43163959-43163981 CAGGAGGTGAGGGTTGAGGAGGG + Intergenic
953620113 3:44525848-44525870 TGGTGGGTGAGGGGCCAGGCTGG - Intergenic
953788674 3:45929964-45929986 TTGAGGCTGAGGGATGAGGAGGG - Intronic
954091615 3:48288947-48288969 GAGTGGGTGAGTGGTGAGAGAGG + Intronic
954177735 3:48857871-48857893 GAGTGGGTGTGGGGTTAGGGAGG - Intronic
954405867 3:50344806-50344828 TGGTGGGGAAGGGGTGGGGAGGG - Intronic
955964494 3:64374462-64374484 TAGAAGGTGAGGGATGAGGGAGG + Intronic
956401092 3:68880866-68880888 GAGTCAGTGAGGGCTGAGGAAGG + Intronic
957899995 3:86476954-86476976 AAATGGGTGAGAGGTGGGGATGG - Intergenic
958620531 3:96552501-96552523 AAGGGGCTGAGGGTTGAGGAGGG - Intergenic
960695418 3:120391249-120391271 AAGGGACTGAGGGGTGAGGAAGG - Intergenic
961094482 3:124142745-124142767 GAGTGGGTGGGGGGTGGAGATGG - Intronic
961167786 3:124775659-124775681 TAGTGGGTGACTGGAGAGGCAGG + Intronic
961384566 3:126516453-126516475 TGGTGGGTGCTGGGTGATGAGGG - Intronic
961451557 3:127004536-127004558 TAGGGAGTCAGAGGTGAGGATGG + Intronic
961520252 3:127463307-127463329 TGGTGGGTGGGGGCTGGGGAAGG - Intergenic
961535075 3:127565638-127565660 ATGTGGGTGAGGGGTGAGCCAGG - Intergenic
962370899 3:134820045-134820067 GGGTGGGTGAGGGGAGGGGAAGG - Intronic
962380867 3:134897323-134897345 TCTTGGGTCAGGGGTGAGGGAGG + Intronic
962702416 3:138012429-138012451 AGGTAGGTGAGGGGTTAGGAAGG - Intronic
962714710 3:138116000-138116022 TGGTGGGTGGGGGCTGCGGAGGG - Intergenic
962927867 3:140011842-140011864 CAGTGGGTGTGGGGTGAGAGTGG + Intronic
963076081 3:141347529-141347551 GAGTAGGTGAAGGGTGAGGAAGG - Intronic
964230230 3:154457572-154457594 TTCTGGGTGAGGAGTGAGGTGGG - Intergenic
965039059 3:163482747-163482769 CAGAGGGAGAGGGGTGAGGAAGG - Intergenic
965496128 3:169401314-169401336 AAGTGGGTCAGGGGTGGGGGTGG - Intronic
965700886 3:171458913-171458935 AAGGGGGTGAGGGGTGGGGATGG - Intronic
966396944 3:179513916-179513938 TAGGGGTTGAGGGATCAGGAAGG - Intergenic
966422247 3:179745235-179745257 TGGTGGCAGTGGGGTGAGGAGGG + Intronic
967225502 3:187287322-187287344 AAGTAGGTGAGGAGTGAGCAGGG - Intronic
967478628 3:189949336-189949358 GAGTGGGGGAGGGGAGGGGAGGG - Intergenic
967763650 3:193252962-193252984 ATGTGGGTGAGCGGTGAGTAGGG + Intronic
967994500 3:195156391-195156413 GAGAGGGTGAAGGGTGGGGAGGG + Intronic
968829940 4:2928147-2928169 TAGTGGGTGAGGTGAGAGATGGG - Intronic
968916292 4:3498419-3498441 TGGGCGGTGAGGGGTGAGGGTGG - Intronic
968925231 4:3543505-3543527 GAGTGGGTGGGGGGTTATGAAGG - Intergenic
968961393 4:3746022-3746044 GAGTGGGGGAGGGGCGGGGAGGG + Intergenic
969101931 4:4775820-4775842 TGGAGGGAGAGGGGTGGGGAGGG + Intergenic
969331304 4:6474706-6474728 GGGGTGGTGAGGGGTGAGGAGGG - Intronic
969376978 4:6769369-6769391 GAGTGGGGGTGGGGAGAGGAAGG - Intergenic
969433937 4:7173162-7173184 TAGGGGGTCAGGAGTGTGGACGG + Intergenic
969575972 4:8036023-8036045 GTGTGGGTGAGTGGTGAAGATGG + Intronic
970192333 4:13528524-13528546 AAGTGGGTAGAGGGTGAGGAGGG + Intergenic
970448812 4:16147374-16147396 TTTTGGGGCAGGGGTGAGGATGG + Intergenic
970559576 4:17269479-17269501 TAGTAGGTGTGGAGTGAGGAGGG - Intergenic
970715447 4:18916720-18916742 AAGGGGGTTAGGGGTGGGGAAGG - Intergenic
970820471 4:20205837-20205859 TTGTGGGCCAGGGGTCAGGAGGG + Intergenic
971177080 4:24292484-24292506 GTGGGGGTGAGGGGTTAGGAAGG - Intergenic
971470312 4:27018026-27018048 TTGGGGGTAAGGTGTGAGGAGGG + Intronic
973770119 4:54198552-54198574 AAGGGGCTCAGGGGTGAGGAAGG + Intronic
973818848 4:54644646-54644668 TAGTGGGGGAGGTGGGAGGCTGG + Intergenic
974346913 4:60693983-60694005 TGGAGGGTGGGGGGTGAGGTTGG + Intergenic
974912362 4:68138017-68138039 ATGTGTGGGAGGGGTGAGGAAGG + Intergenic
975477925 4:74844316-74844338 GTGGGGGTGAAGGGTGAGGACGG - Intergenic
975647961 4:76564316-76564338 AAGTGGTTGAGAGGAGAGGAAGG + Intronic
976114255 4:81710194-81710216 TGGGGGGTGAGGGGGGAGGTGGG - Intronic
977231274 4:94453037-94453059 TAGTGGGTGAGAGGGGAGAAAGG - Intronic
977250843 4:94687078-94687100 TAGTGAGTGTGGGGTGTGCATGG - Intergenic
977697476 4:99982214-99982236 CAATGGGAGAAGGGTGAGGAGGG - Intergenic
977873092 4:102116977-102116999 TGGGGGGTGGGGAGTGAGGATGG - Intergenic
978526750 4:109675401-109675423 TAGTGTGTGTGGTGTGAGGGGGG - Intronic
978628466 4:110714910-110714932 AAGTGGCTGAGGTGGGAGGATGG + Intergenic
979483503 4:121245147-121245169 TAGTGGGTTAGGGAAGAAGAAGG + Intergenic
979745571 4:124208815-124208837 TAGTGGGTGAAGGTTGGTGAGGG - Intergenic
980627300 4:135390265-135390287 TGGATGGTGAGGGGTGGGGATGG + Intergenic
981220149 4:142222248-142222270 TAGTGGGTAAGGGCTGGGCATGG - Intronic
981265249 4:142775514-142775536 GAGTAGGGGAGGGGTGGGGAGGG - Intronic
981837988 4:149077835-149077857 GAGTGGGGGTGGGGGGAGGAGGG - Intergenic
982913539 4:161175905-161175927 AAGTGGATGAAGGGGGAGGAGGG + Intergenic
984039029 4:174705833-174705855 TAGTGGGGTGGGGGTGGGGAGGG + Intronic
985451578 4:190066264-190066286 TGGGGGGTGGGGGGTGGGGATGG - Intergenic
985544745 5:503982-504004 GAGAGGGTGAAGTGTGAGGAAGG - Intronic
985749706 5:1667283-1667305 GAGGGGGGGAGGGGGGAGGAGGG - Intergenic
986448418 5:7843637-7843659 CTGGGGGTGAGGGGTGAGTAGGG - Intronic
986541773 5:8851968-8851990 TAGTGAGTGTGGTGGGAGGATGG - Intergenic
986772801 5:10988923-10988945 GAGTGGCTGAGGTGTAAGGAGGG - Intronic
987091173 5:14509059-14509081 TGGTGGGTGGGGGGTGGGTAGGG - Exonic
987368073 5:17167753-17167775 AAAAGGATGAGGGGTGAGGATGG + Intronic
988427096 5:31076478-31076500 TGGTGGGGGTGGGGTGGGGAGGG - Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
989173779 5:38500078-38500100 TAGAGGCTGAGGGATAAGGAGGG - Intronic
990052761 5:51528271-51528293 TAGGGGGTGAGGAGTAGGGAGGG + Intergenic
990817352 5:59800607-59800629 TAGGGGGGTAGGGGTGGGGAGGG - Intronic
991376125 5:65969174-65969196 TATTGGGTGTGGGGTGACCATGG - Intronic
991419393 5:66426026-66426048 TAGTGGGTGGGTGGTAGGGAGGG + Intergenic
991927502 5:71719516-71719538 GAGTGGGGGTGGGGGGAGGAGGG - Intronic
992077620 5:73205681-73205703 TCCTTGGTGAGGGGTAAGGAAGG - Intergenic
992079637 5:73222921-73222943 TGGTGGGTCAGGGAGGAGGAGGG + Intergenic
992081181 5:73235045-73235067 TATTGGGCGAGGGGTGGGGTGGG - Intergenic
993536928 5:89098430-89098452 GAGTGGGGGAGGGATGGGGAGGG - Intergenic
993885158 5:93407570-93407592 GGGTGGGGGTGGGGTGAGGAGGG - Intergenic
995059692 5:107799924-107799946 TATTGAGTGGAGGGTGAGGAGGG + Intergenic
995887784 5:116915703-116915725 AAGTGGGTGTGGGGTGCTGAAGG + Intergenic
996012337 5:118494852-118494874 TTTTGTATGAGGGGTGAGGAAGG - Intergenic
996700462 5:126445620-126445642 TGGGGAGTGGGGGGTGAGGAGGG + Intronic
996969959 5:129353922-129353944 TGGTGGGGGAGAGGTGGGGATGG + Intergenic
997105454 5:131013743-131013765 TGGTGGGGGAGGAGTGGGGATGG + Intergenic
997229019 5:132229264-132229286 GAGTGGGAGAGATGTGAGGATGG - Intronic
997311880 5:132892791-132892813 TATTGGGGTAGGGGTGAGTATGG - Intronic
997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG + Intronic
997646996 5:135488383-135488405 ATGGGGGTGAGGTGTGAGGAAGG + Intergenic
998036720 5:138923627-138923649 TAGAGGCTGAGGCGGGAGGATGG - Intronic
998131938 5:139655742-139655764 TGGTGGGGGAGGGGGCAGGAAGG - Intronic
998662025 5:144249417-144249439 TTGTGGGAGAGGGGAGGGGAAGG - Intronic
999007211 5:147996282-147996304 GAGTGGTTGAGTGGGGAGGAGGG + Intergenic
999177653 5:149642660-149642682 TTGTGGGTGAAGGCTGAGGTGGG - Intergenic
999238890 5:150115961-150115983 CAGTGAGTGAGGGGCTAGGAAGG + Intronic
999328762 5:150659113-150659135 TAGTGGGTTAGAGGAGAGGTTGG - Intronic
999529458 5:152446405-152446427 CAGGGGGTGAGGTGTAAGGAGGG - Intergenic
1000133619 5:158323238-158323260 TGGAGGGTGACAGGTGAGGAGGG + Intergenic
1000171426 5:158706630-158706652 AAGTCAGGGAGGGGTGAGGAAGG - Intronic
1000399174 5:160807266-160807288 TATTTGGTGAGGGGCAAGGAAGG + Intronic
1000751278 5:165098996-165099018 TAGGGGTTGAGGGGTGAGAGAGG - Intergenic
1001438291 5:171718164-171718186 AGGTGGGGGAGGGGTGTGGAGGG - Intergenic
1001731378 5:173962945-173962967 CAGCGGGTGAGGGGTGCTGAGGG - Intergenic
1001803996 5:174567818-174567840 TATTGGGTGAGCAGTGAGCAGGG + Intergenic
1002419712 5:179139276-179139298 AAGTGGCTGCGGGCTGAGGAGGG + Intronic
1002439978 5:179259186-179259208 AAGTACCTGAGGGGTGAGGACGG - Intronic
1002458211 5:179358051-179358073 CAGTGGGAGTGGGGTGAGGAGGG + Intergenic
1002689828 5:181043001-181043023 CAGTGGGTGAGTGGTGGGGTGGG - Intronic
1002701862 5:181130310-181130332 TAGTCGGTGCGGGCTGAGGAAGG - Intergenic
1002703935 5:181147836-181147858 TAGTCGGTGCGGGCTGAGGAAGG + Intergenic
1002942993 6:1733983-1734005 TAGTGGGACAGGGGAAAGGAGGG + Intronic
1003232541 6:4267703-4267725 GACTGGATGAGGGGCGAGGATGG + Intergenic
1003667531 6:8125658-8125680 AAGGGGGTGAAGTGTGAGGATGG - Intergenic
1004210643 6:13638852-13638874 TTGGGGGTGGGGGGAGAGGAGGG + Intronic
1004991621 6:21144853-21144875 AATTGAGTGTGGGGTGAGGAGGG + Intronic
1005032085 6:21518788-21518810 TGGTGGGTGAAGGCTGAGGTGGG + Intergenic
1005224980 6:23632216-23632238 GAGTAGGTGAGGTGTCAGGAGGG - Intergenic
1005426428 6:25707457-25707479 CAGTGGTTGGGGGGTGAGGAGGG + Intergenic
1005506421 6:26472757-26472779 TAGACGTTGAAGGGTGAGGAGGG + Intronic
1005563743 6:27068185-27068207 GAGTGGCTGAGGGCTGAGGTGGG - Intergenic
1005583708 6:27256210-27256232 TGGTGAGTGAAGGGTGTGGAAGG - Exonic
1005652809 6:27900203-27900225 TATTGGGTGGGGGGTCAGGGTGG - Intergenic
1006425239 6:33959339-33959361 GTGGGGGTGAGGGGTGAGGGGGG + Intergenic
1006621880 6:35370992-35371014 GAGAGGGTGTGGGGTGAGTAGGG - Intronic
1007172729 6:39875505-39875527 GAGTGGGAGAGTGATGAGGAAGG - Intronic
1007190038 6:40006464-40006486 TATTGGGTGTGGTGTGAGGTAGG + Intergenic
1007326610 6:41066229-41066251 TAGAGGTTGAGGCGGGAGGATGG - Exonic
1007378026 6:41469551-41469573 GAGGGGGTGAGGGGTGAGGGAGG + Intergenic
1007395497 6:41575541-41575563 TAGGGGGTGTAGGGGGAGGAAGG + Intronic
1007420510 6:41716467-41716489 GAGTGGGTGGGTGGTGGGGATGG - Intronic
1007615208 6:43175808-43175830 TAGTTGGTGATGGGAAAGGAGGG - Exonic
1007669693 6:43541113-43541135 TGGTGGGTTAGGGGTAAGGTAGG + Intronic
1007768742 6:44176997-44177019 TGGTGGGTGAGGGGTGAGAGGGG + Exonic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1008659045 6:53646612-53646634 CAGGGAGGGAGGGGTGAGGAGGG + Intergenic
1009029996 6:58045363-58045385 TGTGGGGTGAGGGGTGGGGAGGG + Intergenic
1009047285 6:58247064-58247086 TTGGGGGTGGGGGGAGAGGAGGG + Intergenic
1009205524 6:60796593-60796615 TGTGGGGTGAGGGGTGGGGAGGG + Intergenic
1010203135 6:73299858-73299880 AAGTGGGGGCGGGGTAAGGAGGG + Intronic
1010392074 6:75349353-75349375 TGGTGGTGGAGGGGTGAGGTTGG - Intronic
1010447780 6:75967342-75967364 TGGTGGGTTGGGGGTGAGAAGGG + Intronic
1010776046 6:79887103-79887125 GAGTGAGAGAGAGGTGAGGATGG + Intergenic
1011632383 6:89339638-89339660 GAGTGGGGGAGGGGAGGGGAGGG + Intronic
1011741060 6:90361185-90361207 TACTGGGTGAGGGGTGTAGGAGG - Intergenic
1012791340 6:103701300-103701322 TAATGAGTGAGAGGTGTGGAGGG - Intergenic
1012901990 6:105017267-105017289 GTGTGGGTGAGGGGTAAGGGTGG + Intronic
1013087355 6:106867672-106867694 GAGTCGGTGAGGGTTGAGGGGGG + Intergenic
1013601430 6:111708692-111708714 TCATGGGCAAGGGGTGAGGATGG + Intronic
1015552192 6:134423202-134423224 TGTTGGGTGGGAGGTGAGGAAGG + Intergenic
1016440930 6:144082621-144082643 AAGTGGGTGTGGGGGGAGGGGGG + Intergenic
1017236175 6:152119589-152119611 AAGTGAGTGCTGGGTGAGGAAGG - Intronic
1017356678 6:153518007-153518029 TTGTGTGTGAGGCGTAAGGAAGG + Intergenic
1017637303 6:156456075-156456097 GAGTGGAGGAGGGGGGAGGAGGG - Intergenic
1018001238 6:159580501-159580523 CAGAGGGCGATGGGTGAGGAGGG + Intergenic
1018639054 6:165890061-165890083 GAGTGAGTGAGGAGTGAGGGAGG - Intronic
1018661093 6:166087860-166087882 TAGGGGGTGGGGGGTGAGTGTGG + Intergenic
1018813711 6:167316322-167316344 TAATGGGGGAGGGCTGGGGAGGG - Intergenic
1018943168 6:168324093-168324115 GGGTGGGAGAAGGGTGAGGAAGG - Intergenic
1019040040 6:169096157-169096179 TGGGGGGTGAGGAGGGAGGAGGG - Intergenic
1019261532 7:84546-84568 CTCTGGGTGAGGAGTGAGGAAGG - Intergenic
1019571922 7:1716845-1716867 TGGAGGGGGAGGGGAGAGGAAGG + Intronic
1019666055 7:2252800-2252822 TAGGAGGGCAGGGGTGAGGAGGG - Exonic
1019804461 7:3113065-3113087 TAGTGGGTGAGGAGTGGGAGAGG + Intergenic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020441910 7:8226245-8226267 TGGTGGATGAGGAGTGGGGAAGG - Intronic
1021019086 7:15573987-15574009 CAGTGGGTGGGGCGTGGGGACGG + Intergenic
1022503469 7:30896704-30896726 TGGTGGGTGAGGTGTGGGGCTGG - Intergenic
1022528791 7:31054188-31054210 AAGTGTGTGTGGGGTGACGATGG + Intronic
1023000170 7:35800734-35800756 TAGTGGGTGGGGTGCGAGGGTGG - Intergenic
1023362998 7:39434776-39434798 TAGGGGGTGGGATGTGAGGAGGG - Intronic
1024254206 7:47527801-47527823 GAGTGGCTGAGGTGGGAGGATGG + Intronic
1025609611 7:63066863-63066885 TAGTGAGGGATGGGGGAGGAAGG + Intergenic
1025763625 7:64418960-64418982 AATAGGGTGAGGGGTTAGGATGG - Intergenic
1026275137 7:68870004-68870026 AGGTGGGTAAGGGGTAAGGAGGG + Intergenic
1026550800 7:71366799-71366821 TAGGGAGTCAGGTGTGAGGAAGG - Intronic
1026748133 7:73028421-73028443 TGGTGGGAGAGGGATCAGGATGG + Intergenic
1026751781 7:73056566-73056588 TGGTGGGAGAGGGATCAGGATGG + Intergenic
1026755430 7:73084693-73084715 TGGTGGGAGAGGGATCAGGATGG + Intergenic
1026759080 7:73112707-73112729 TGGTGGGAGAGGGATCAGGATGG + Intergenic
1026874891 7:73873555-73873577 GGGTGAGTGGGGGGTGAGGAGGG + Intergenic
1027034336 7:74913735-74913757 TGGTGGGAGAGGGATCAGGATGG + Intergenic
1027088328 7:75280766-75280788 TGGTGGGAGAGGGATCAGGATGG - Intergenic
1027091970 7:75308694-75308716 TGGTGGGAGAGGGATCAGGATGG - Intergenic
1027095613 7:75336661-75336683 TGGTGGGAGAGGGATCAGGATGG - Intergenic
1027323728 7:77031025-77031047 TGGTGGGAGAGGGATCAGGATGG + Intergenic
1028089578 7:86681563-86681585 TGGTGGCTGGGGGGTGAGGCGGG + Intronic
1028420325 7:90625697-90625719 TGCTGGGGGATGGGTGAGGAGGG - Intronic
1029395718 7:100307385-100307407 TGGTGGGAGAGGGATCAGGATGG - Intergenic
1029465024 7:100720212-100720234 TAGACGGTGAGGAGTGAGGTGGG + Intergenic
1029487427 7:100852262-100852284 CAGCGGGTGAGGGGCGAGGCTGG + Intronic
1030161708 7:106516150-106516172 AAGAGTGTGAGGTGTGAGGATGG - Intergenic
1030663498 7:112248299-112248321 TAGGGGGTGGGGGTTGAGGGGGG + Intronic
1030998769 7:116390201-116390223 GAGTGGGGAAGGGGTGAGGTGGG + Intronic
1031045638 7:116884417-116884439 TAGAAGCTGAGGGGTGGGGAAGG - Intronic
1031294559 7:119984798-119984820 TAGTGAGTGAGGAGTGAGTGAGG - Intergenic
1031491792 7:122398771-122398793 GAAGGGGTGAGGGGTGGGGAGGG - Intronic
1031510568 7:122643725-122643747 AAGAGGGAGAGGGATGAGGAAGG + Intronic
1031525117 7:122816170-122816192 TAGTGGGTAAGGGGTGGGTGGGG - Intronic
1031692910 7:124812937-124812959 GAGCGGGTGGGGGGTGGGGAGGG - Intergenic
1031927935 7:127656005-127656027 AAGTGGGTGAGGGGAGGGTAAGG - Intronic
1031973505 7:128079849-128079871 TTGTTGGTGGGGGGTGGGGAGGG - Intronic
1032652869 7:133897990-133898012 GGGTGGGTGTGGGGTGAGGTGGG - Intronic
1032708536 7:134442942-134442964 TAGTGGTAGAGGGGTCTGGAGGG - Intronic
1032735879 7:134692267-134692289 TGGTGGGTGAGGGGTGGGGTGGG - Intergenic
1033278312 7:139988932-139988954 TGGTGTGTGAGGGGAGAGGCAGG + Intronic
1033303338 7:140205833-140205855 TAGTGGGGGAGGGTCGGGGATGG + Intergenic
1033343483 7:140509800-140509822 TCGAGGGTGAGGTGGGAGGATGG - Intergenic
1033807674 7:144973199-144973221 AAGTGGGAGAGGGGCGAGGTGGG + Intergenic
1034002809 7:147434949-147434971 TTGTGTGTGAGGGTTGAGGTGGG + Intronic
1034425236 7:151010519-151010541 CAGTGGGGGAGGGGTCAAGAAGG + Intronic
1034875500 7:154721321-154721343 TGGTGGGTCAGGGGTGCGGCTGG - Intronic
1035230554 7:157463533-157463555 ATGAGGGTGAGGGGTGAGGATGG - Intergenic
1035245655 7:157560717-157560739 AATTGGGTGAGGTGGGAGGAGGG - Intronic
1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035526419 8:316673-316695 TAGTGGCTGTGGGGTGGGGCTGG + Intergenic
1035925329 8:3721950-3721972 CAGGAGGTGAGGGATGAGGACGG - Intronic
1036258959 8:7225817-7225839 AGGTGGGGGAGGGGGGAGGATGG - Intergenic
1036311012 8:7684413-7684435 AGGTGGGGGAGGGGGGAGGATGG - Intergenic
1037261962 8:17019630-17019652 TGGTGGGCGTGGGGTGGGGAGGG - Intergenic
1037543770 8:19897937-19897959 AAGAGGGAGAGGAGTGAGGAAGG - Intergenic
1037570078 8:20150496-20150518 CAGTGAGTGAGTGGTGAGGGTGG - Intronic
1037771377 8:21802108-21802130 TACAGGGTGAGGAGTGAGAAGGG - Intronic
1037856417 8:22374411-22374433 TACTGGGTGAGGCCAGAGGAGGG + Intronic
1038125507 8:24668889-24668911 TAGGAGGTCAGGGATGAGGAAGG - Intergenic
1038545958 8:28425872-28425894 CAGGGGGTGAGGCGGGAGGATGG - Intronic
1038623766 8:29170576-29170598 TAAAGGGAGAGGGGAGAGGAGGG + Intronic
1038642916 8:29341756-29341778 TAGAGGATGAGGGAAGAGGAAGG + Intronic
1039755112 8:40514368-40514390 TTGTGGGGGAGGGGTGGGGAGGG + Intergenic
1040102338 8:43516717-43516739 TGGTGGGTGAGGGTGGAGGATGG + Intergenic
1040590313 8:48786796-48786818 GAGTGGGTGTGGCATGAGGAAGG + Intergenic
1040737247 8:50523123-50523145 TAAAGGCTGAGAGGTGAGGAAGG - Intronic
1040819896 8:51544663-51544685 TAGGTTGTGGGGGGTGAGGAAGG - Intronic
1040852884 8:51920211-51920233 AGGTGGGTCAAGGGTGAGGAAGG - Intergenic
1041090656 8:54298052-54298074 CAGTGGGTGGGAGGTGGGGAGGG + Intergenic
1041170349 8:55135734-55135756 TGCTGGGTCAGGGGTCAGGAAGG - Intronic
1041735762 8:61108973-61108995 TGGAGGGAAAGGGGTGAGGAGGG + Intronic
1041896212 8:62927171-62927193 GAGTGGGAGGGGGGTGAGGAAGG - Intronic
1042217157 8:66438326-66438348 TAAAGGGTGAGGGAGGAGGAAGG + Intronic
1042703992 8:71647405-71647427 AAGTGGGAGGAGGGTGAGGATGG + Intergenic
1042739372 8:72026247-72026269 CAGTGGGTGAGGTGAGAGGAAGG - Intronic
1043130611 8:76456144-76456166 TTGGGGGTGTGGGGTGAGGAAGG + Intergenic
1043417738 8:80068761-80068783 TAGTGTCTCAGGGGTAAGGATGG + Intronic
1043868571 8:85403264-85403286 TTGTGGGTGAGGGGTGGGGCTGG + Intronic
1044738461 8:95302088-95302110 TAGTGGTGGAAGGGTGGGGATGG + Intergenic
1044937525 8:97307653-97307675 TTGAGGGTGAGGGCAGAGGAGGG - Intergenic
1045204637 8:100025447-100025469 ACATGGGTGAGGGGTGAGGTTGG - Intronic
1045244290 8:100429450-100429472 TAGGGGGGAAGGGGTGAGGTGGG - Intergenic
1045295129 8:100865907-100865929 GAGTGAGTGAGGGGTGATGCTGG - Intergenic
1045362483 8:101445768-101445790 CAATGGGTGAGGGGGAAGGAGGG + Intergenic
1045625932 8:104050400-104050422 TAGTGGGATTGGGGTGGGGAAGG + Intronic
1045824052 8:106375952-106375974 CAGAGGCTGAGGTGTGAGGATGG - Intronic
1045899566 8:107261307-107261329 TTGGGGGTGAGGGCTGAGGGAGG + Intronic
1046108488 8:109693234-109693256 TAGAAGGGGAGGGGTGGGGAGGG - Intergenic
1047786650 8:128159846-128159868 TTGGGGGTGAGGGGACAGGAAGG - Intergenic
1049268370 8:141681457-141681479 GAGGGGGTGATGGGGGAGGAGGG + Intergenic
1049368589 8:142252831-142252853 AAATGGCTGAGGGGTGGGGAGGG - Intronic
1049422650 8:142523771-142523793 TACTGGGAGGGGGGTGGGGAGGG + Intronic
1049597672 8:143492247-143492269 CAGTGGGTGGCCGGTGAGGAGGG - Intronic
1049836975 8:144742471-144742493 TAGTGGGGGAGGTGTGTGGGGGG - Intronic
1050325185 9:4491142-4491164 CTGGGGGTGTGGGGTGAGGAAGG - Intronic
1050728319 9:8677519-8677541 TTGAGGGTGGAGGGTGAGGAGGG + Intronic
1051081381 9:13298182-13298204 TAGGGTATGAGGGATGAGGAGGG + Intergenic
1051311218 9:15774954-15774976 GAAAGGGTGAGGGGTGACGAGGG + Intronic
1051338657 9:16091277-16091299 TGGTGAGTGTGGGGTGAGGGTGG - Intergenic
1051387544 9:16525067-16525089 GAGTGGGGGAGGGGGGGGGAAGG + Intronic
1051706165 9:19882494-19882516 AAGTGGGTGGGGGGCGTGGAGGG - Intergenic
1052253413 9:26426515-26426537 TACTGGTTGAGGGGTTAAGATGG + Intergenic
1052394709 9:27924880-27924902 TTGTTGGTGAAGGGAGAGGAGGG - Intergenic
1053310026 9:37012008-37012030 TGGGGGTTTAGGGGTGAGGAAGG + Intronic
1053342323 9:37348015-37348037 GAGTGGCTGTGGGCTGAGGAAGG - Intronic
1053800121 9:41758687-41758709 GAGTGGGTGGGGGGTTATGAAGG - Intergenic
1054145071 9:61556148-61556170 GAGTGGGTGGGGGGTTATGAAGG + Intergenic
1054188549 9:61970839-61970861 GAGTGGGTGGGGGGTTATGAAGG - Intergenic
1054464767 9:65487105-65487127 GAGTGGGTGGGGGGTTATGAAGG + Intergenic
1054649972 9:67617778-67617800 GAGTGGGTGGGGGGTTATGAAGG + Intergenic
1055930164 9:81551951-81551973 TAATGGGAGGGGGGTGAGGCTGG + Intergenic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056805940 9:89728956-89728978 TAGTGAGAGTGGGATGAGGAGGG - Intergenic
1057195969 9:93115760-93115782 GAGTGAGGGAGGGGTGAGGGAGG + Intergenic
1057200865 9:93139368-93139390 GAGTGGGTGAGGGGAGGGCAAGG - Intergenic
1059053274 9:110952384-110952406 TAGAGGGTGAGGGGGAAGGTGGG - Intronic
1059095283 9:111406796-111406818 TAGGAGGTGAGGTGGGAGGATGG + Intronic
1059148883 9:111929041-111929063 TGGGGGGTGGGGGGTGGGGAGGG - Intronic
1059349856 9:113656866-113656888 GAGGAGGTGAGGGGTGAGGTGGG + Intergenic
1059438264 9:114289148-114289170 TGGAGGGGGAGGGGTGGGGAGGG - Intronic
1059641303 9:116219545-116219567 TATTGAGTGGGGGGTGAGGGAGG + Intronic
1059768186 9:117403549-117403571 TGGTGGCTGAGGGCGGAGGAGGG - Intronic
1059940426 9:119353971-119353993 TAGTGGGTCAAGGGAGAGGGAGG - Intronic
1060260896 9:122072733-122072755 TGGAGGATGAGGGGTGAGCAAGG - Intronic
1060446883 9:123697683-123697705 AAGTGGGGGAAGGGGGAGGAAGG - Intronic
1060871741 9:127048152-127048174 GATTGGGTGTGTGGTGAGGAGGG - Intronic
1060917094 9:127397838-127397860 GAGTGGGTGGAGGGGGAGGATGG + Intronic
1061298000 9:129687343-129687365 GGGTTGGTGAGGGGTGTGGAGGG + Intronic
1061301219 9:129705966-129705988 CAGGGGGTGAGGAGTGAGGTGGG - Intronic
1061537764 9:131260150-131260172 TCTTGGGAGAAGGGTGAGGATGG - Exonic
1061826431 9:133261044-133261066 TGGTGGAGGAGGGGTGGGGATGG + Intronic
1062105518 9:134752831-134752853 TTGTTGGTGGGGGGTGGGGATGG + Intronic
1062255894 9:135620273-135620295 TAGGGGGAGAAGGGTGAGAAGGG - Intergenic
1062329001 9:136028570-136028592 TAGTGGGTGAGGCGTGGCCAGGG + Intronic
1202630999 M:16250-16272 TAGTGGGTGAGGGGTGGCTTTGG - Intergenic
1203473037 Un_GL000220v1:125180-125202 GAGGGGGTGCGGGGTGGGGACGG + Intergenic
1185511663 X:668310-668332 AAGTGGGGGAGGGGAGGGGAGGG - Intergenic
1185631094 X:1516286-1516308 TTGTGGGAGAGGGGTGAAGAAGG - Intronic
1185927538 X:4163927-4163949 CAGAGGCTGAAGGGTGAGGAGGG + Intergenic
1186523632 X:10228222-10228244 GAATGGGGGAGGGGGGAGGAGGG - Intronic
1186611348 X:11140650-11140672 TGGACTGTGAGGGGTGAGGAGGG - Intronic
1187010176 X:15270584-15270606 GAGTGGAGGAGGGGTGAGGTAGG - Intergenic
1187521917 X:20021501-20021523 TGGGAGGTGAGGAGTGAGGAAGG - Intronic
1187618308 X:21021914-21021936 TGGGGGGTGGGGTGTGAGGAGGG + Intergenic
1187884138 X:23873180-23873202 TATTGGGGGTGGAGTGAGGATGG - Intronic
1189005306 X:36987823-36987845 TTATGGTTGAGGGATGAGGAAGG - Intergenic
1189043721 X:37570119-37570141 TTATGGTTGAGGGATGAGGAAGG + Intronic
1189474044 X:41335061-41335083 GAGTGGGGGAGGGGTGGGGGCGG + Intronic
1189532192 X:41896923-41896945 TAGTGGGGGAGGAGGGAGTAGGG - Intronic
1189709014 X:43789927-43789949 GATTGGGTGGGGGGTGTGGAGGG + Intronic
1190503365 X:51100964-51100986 TTGGGGGTGAGGGGTCAGGGTGG - Intergenic
1191891104 X:65942294-65942316 TGGTGGGAGGAGGGTGAGGATGG - Intergenic
1191976503 X:66877762-66877784 GAGTGGGAGAAGGGAGAGGAGGG - Intergenic
1192271399 X:69583207-69583229 TGGTGGGGGTAGGGTGAGGATGG - Intergenic
1192314046 X:70038295-70038317 TAGAGGGCGAGGGATGATGAGGG + Exonic
1192563709 X:72145131-72145153 TATTGGGTGAGGGGTGAAGTAGG - Intergenic
1192705119 X:73521047-73521069 CAGTGGATGAGGGTTCAGGAAGG + Intergenic
1193278535 X:79620837-79620859 CTGGGGGTGAGGGGTGGGGAGGG - Intergenic
1193597657 X:83466720-83466742 TGGGGGGTGGGGGGTGAGGGGGG - Intergenic
1193846142 X:86473503-86473525 TAGTGGGTGATGGGGGAGGAAGG - Intronic
1195401599 X:104466798-104466820 AAGTGGCCAAGGGGTGAGGAAGG + Intergenic
1195648881 X:107264029-107264051 AAGTGGGTGAGGTGGGAGGTAGG - Intergenic
1195824464 X:108982964-108982986 TAGTGGGTGTGGGGTGAATTGGG - Intergenic
1196015149 X:110931332-110931354 GGGTGGGAGAAGGGTGAGGATGG + Intergenic
1196106253 X:111899092-111899114 TAGTGGGTGAGGAGAGGGCAAGG - Intronic
1197581695 X:128291924-128291946 TAGGGGGAGAGGGGTGGGGATGG + Intergenic
1197770405 X:130085811-130085833 TTGTGGGGGAGGGGTGTTGAGGG - Intronic
1198089883 X:133318131-133318153 GAGTGGGGAAGGGGTGAGGATGG - Intronic
1198575305 X:138004191-138004213 TAGAGGGTGAGGGGTAGGGGTGG + Intergenic
1199607228 X:149586553-149586575 GAGTGGGGGGGGGGTGAGGATGG + Intronic
1199840063 X:151636906-151636928 AAATGGGTTAGGGGTGAGGTGGG - Intronic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201559457 Y:15300734-15300756 AAGTGGCTGAGGTGGGAGGATGG - Intergenic
1201699496 Y:16864756-16864778 GGGTGGGGGAGGGGGGAGGAGGG + Intergenic
1202376908 Y:24246304-24246326 TAGCGTGTGTGGGGTGCGGAGGG + Intergenic
1202493872 Y:25423817-25423839 TAGCGTGTGTGGGGTGCGGAGGG - Intergenic