ID: 917310384

View in Genome Browser
Species Human (GRCh38)
Location 1:173671796-173671818
Sequence CACGTAAACCCGGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151553
Summary {0: 2, 1: 145, 2: 5826, 3: 39444, 4: 106136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917310377_917310384 8 Left 917310377 1:173671765-173671787 CCAGCTCCTTGGGAGGATGAGGC 0: 5
1: 1217
2: 92160
3: 267386
4: 420334
Right 917310384 1:173671796-173671818 CACGTAAACCCGGGAGGCGGAGG 0: 2
1: 145
2: 5826
3: 39444
4: 106136
917310379_917310384 2 Left 917310379 1:173671771-173671793 CCTTGGGAGGATGAGGCAGGAGA 0: 3
1: 663
2: 1794
3: 2875
4: 4413
Right 917310384 1:173671796-173671818 CACGTAAACCCGGGAGGCGGAGG 0: 2
1: 145
2: 5826
3: 39444
4: 106136
917310375_917310384 9 Left 917310375 1:173671764-173671786 CCCAGCTCCTTGGGAGGATGAGG 0: 5
1: 1552
2: 106688
3: 317359
4: 474631
Right 917310384 1:173671796-173671818 CACGTAAACCCGGGAGGCGGAGG 0: 2
1: 145
2: 5826
3: 39444
4: 106136
917310373_917310384 17 Left 917310373 1:173671756-173671778 CCTGTAGTCCCAGCTCCTTGGGA 0: 346
1: 44997
2: 168542
3: 526952
4: 477026
Right 917310384 1:173671796-173671818 CACGTAAACCCGGGAGGCGGAGG 0: 2
1: 145
2: 5826
3: 39444
4: 106136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917310384 Original CRISPR CACGTAAACCCGGGAGGCGG AGG Intergenic
Too many off-targets to display for this crispr