ID: 917327858

View in Genome Browser
Species Human (GRCh38)
Location 1:173851537-173851559
Sequence CTGCTGTTCTTGAGGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 296}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917327858_917327862 7 Left 917327858 1:173851537-173851559 CCCTTTTTCCTCAAGAACAGCAG 0: 1
1: 0
2: 2
3: 35
4: 296
Right 917327862 1:173851567-173851589 TGATGAGTGCCATCATGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 119
917327858_917327865 28 Left 917327858 1:173851537-173851559 CCCTTTTTCCTCAAGAACAGCAG 0: 1
1: 0
2: 2
3: 35
4: 296
Right 917327865 1:173851588-173851610 GGCTGAGTCATGATTCTTCAGGG 0: 1
1: 0
2: 1
3: 5
4: 166
917327858_917327864 27 Left 917327858 1:173851537-173851559 CCCTTTTTCCTCAAGAACAGCAG 0: 1
1: 0
2: 2
3: 35
4: 296
Right 917327864 1:173851587-173851609 TGGCTGAGTCATGATTCTTCAGG 0: 1
1: 0
2: 2
3: 13
4: 135
917327858_917327866 29 Left 917327858 1:173851537-173851559 CCCTTTTTCCTCAAGAACAGCAG 0: 1
1: 0
2: 2
3: 35
4: 296
Right 917327866 1:173851589-173851611 GCTGAGTCATGATTCTTCAGGGG 0: 1
1: 0
2: 0
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917327858 Original CRISPR CTGCTGTTCTTGAGGAAAAA GGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
905521380 1:38603150-38603172 CTGCACTTCTGGAGAAAAAAAGG + Intergenic
906584130 1:46961552-46961574 CTGCTCTTCCTGAGAACAAAGGG + Intergenic
908931452 1:69320892-69320914 GTGGTGTGCTTGAAGAAAAAGGG + Intergenic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
910445328 1:87294169-87294191 CTACTCTTCATGAAGAAAAATGG + Intergenic
911244632 1:95503428-95503450 CTGCTGTATTTGGGGAATAAAGG + Intergenic
912557951 1:110529836-110529858 CTGCTGTTCTCGAGGTAAAGAGG + Intergenic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
913358586 1:117952634-117952656 CTCTTATTCTTGAGGAAGAAAGG + Exonic
913563479 1:120047125-120047147 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
914284073 1:146206489-146206511 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914345278 1:146793792-146793814 CTGCTGTTCTGCAGGATCAAGGG - Intergenic
914545104 1:148657228-148657250 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
915057396 1:153147191-153147213 CTGCAATTCTGGAGGAAAACAGG + Intergenic
915604112 1:156940084-156940106 CTGGTGTGCTTGAGGAGAGATGG - Intronic
916869459 1:168896940-168896962 CTGTGGTTCTTAAGGAAAAGTGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG + Intronic
920384180 1:205556421-205556443 CAGCTGTTCTTGAGTAAGCATGG - Intergenic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922244615 1:223783392-223783414 CTGCTGTTGGTGAGGAAGTAAGG - Intronic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
923260240 1:232261385-232261407 CTGGTGCTTTTGAGGAAAACTGG - Intergenic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1064644079 10:17442930-17442952 CTGCTGTTCTAGATTATAAATGG + Intronic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1065154123 10:22852318-22852340 CTGCTGAGTTTGAGGAAGAAGGG + Intergenic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1066521042 10:36219560-36219582 CTGCTGTTCTTGAAACATAAGGG + Intergenic
1066750571 10:38652168-38652190 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1066966479 10:42270944-42270966 CTGCTTTTGGTGAAGAAAAAAGG - Intergenic
1067400904 10:45972543-45972565 CCGCTGTTATTGAGGAGTAACGG + Exonic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067869258 10:49942113-49942135 CCGCTGTTATTGAGGAGTAACGG + Exonic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067901722 10:50248607-50248629 CTGCTGTACCTGAGAAGAAATGG - Exonic
1068213706 10:53955010-53955032 CCTCAGTTGTTGAGGAAAAAGGG - Intronic
1069966971 10:72127461-72127483 AGGCTGTTCCTGAGTAAAAATGG + Intronic
1070142651 10:73749845-73749867 CTGCTCTTCTTGAGAAAGTAAGG - Intronic
1070795638 10:79214833-79214855 CTGCTGTTCATGAGGAAGGCGGG + Intronic
1073676047 10:105648182-105648204 CTGCATTTTTTGAGGAAGAAAGG - Intergenic
1074986127 10:118661519-118661541 GTGGTGTTCCTGAGGAAGAAGGG - Intergenic
1076051080 10:127333625-127333647 CTTTTGTTCTTGAACAAAAAGGG - Intronic
1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1078643778 11:13119545-13119567 CTGTTGTTATTGAGAAAATAGGG - Intergenic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1079870029 11:25785693-25785715 ATTATGTTCTTGTGGAAAAAAGG - Intergenic
1079975309 11:27083740-27083762 CTTCTCTTGTTGGGGAAAAAGGG - Intronic
1080621715 11:33992338-33992360 TTGCAGTTCTAGAGGATAAATGG + Intergenic
1081245409 11:40760319-40760341 CTGCTCTTCGTGCCGAAAAAGGG + Intronic
1081347749 11:42011131-42011153 GTTCTTTTATTGAGGAAAAAAGG - Intergenic
1083009323 11:59381218-59381240 TTGGTATTCCTGAGGAAAAAAGG - Intergenic
1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG + Intronic
1086944890 11:92835200-92835222 CTCCTATTCTTGGGGACAAATGG - Intronic
1088304443 11:108393174-108393196 TTGCTATTCTTGGGGAACAAGGG - Intronic
1088606007 11:111532897-111532919 CTGGTGTATTTGAGAAAAAAAGG - Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1088726083 11:112636468-112636490 CTGCTTTTATGAAGGAAAAAAGG + Intergenic
1089082326 11:115787313-115787335 CTGCTGTTCTTGGAGCAAAATGG + Intergenic
1089625147 11:119746323-119746345 CTCCTGTTCTTTAGAAGAAAGGG + Intergenic
1090184969 11:124732121-124732143 CTGCTGTTTATGAGGAATTAAGG - Intergenic
1090718205 11:129449269-129449291 CTGCTGCTCTTGAAGGAAAGAGG + Intronic
1202823170 11_KI270721v1_random:78160-78182 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1091433759 12:458097-458119 CTGCAGTTCTTTAGCAAAAAGGG - Intergenic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1093185066 12:16010500-16010522 CTGCTTTTGTTGAGGAATCAAGG + Intronic
1093380367 12:18483979-18484001 ATGCTGTTCTCCAGGAAGAAAGG + Intronic
1093393841 12:18656121-18656143 TTGCTGTTTTTGTGGAAGAATGG - Intergenic
1093454234 12:19349165-19349187 CTGCTGTACTGGAGCAAACATGG + Intronic
1093855054 12:24092118-24092140 CTGATGTTCTTGAGGTCAAATGG - Intergenic
1097884967 12:64719950-64719972 ATGCTGTTCTTGAAGGCAAAGGG - Intronic
1098921298 12:76304571-76304593 ATGCTGTTCTTCTGGAAGAAAGG - Intergenic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1100715202 12:97298348-97298370 CAGCTGTTCTGGAGGGAATATGG + Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1102836908 12:116072300-116072322 CTGGTTTTCTTGATGAACAATGG + Intronic
1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG + Intergenic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1105853253 13:24354415-24354437 TTGCTGTTCTTGGGGAGCAATGG - Intergenic
1108697141 13:52912538-52912560 CTGCTGCTCTAGAGAAATAAGGG - Intergenic
1110146640 13:72199978-72200000 CTGCTGTTTTTGAAAAACAAAGG - Intergenic
1110308947 13:74023879-74023901 CTGGTGATCTTGAAGAAAAGGGG + Intronic
1110645133 13:77873849-77873871 CTGCTGTGCTTGAGTAGAAGTGG + Intergenic
1111415557 13:87938993-87939015 CTGCAATTCTTGAGGGGAAATGG + Intergenic
1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG + Exonic
1112717915 13:102207590-102207612 CATCTGTCCTTGAGAAAAAAGGG + Intronic
1113373097 13:109740429-109740451 CTGCTGTTATAAAGGAAAAGAGG + Intergenic
1113441725 13:110334288-110334310 CTGCTGTGCTTGATAAACAAAGG - Intronic
1114876193 14:26721674-26721696 TTGCTGTTCTGTAGGAATAAAGG + Intergenic
1115257054 14:31414561-31414583 CTGATGTGCTGGAGGAATAATGG - Intronic
1116614759 14:47120514-47120536 CTTCTGTTCCTGAAGAAAATAGG - Intronic
1117025567 14:51616547-51616569 CTGCTGCTGAGGAGGAAAAAAGG - Intronic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1117834874 14:59793415-59793437 CTTCTGTACTTAAGAAAAAAAGG - Intronic
1119214221 14:72856284-72856306 CTCCTGTTTTAGAGGAGAAAAGG - Intronic
1119324222 14:73750010-73750032 CTGCTTTTCCCTAGGAAAAATGG + Intronic
1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG + Intergenic
1121072587 14:91037988-91038010 CTATTGTTCTGGAGGAAATAGGG + Intronic
1122018979 14:98820762-98820784 CTGATGCTCTTGGGGAAAATGGG - Intergenic
1122879130 14:104682166-104682188 CTGCTATTCTACAGGAGAAAGGG + Intergenic
1122914813 14:104853950-104853972 CTGCGGTTCATCAGGGAAAATGG - Intergenic
1123111479 14:105869580-105869602 CAACTGTTCTTGAAGAAAAAAGG - Intergenic
1123215253 14:106803251-106803273 CTGCTTTTCATCAGCAAAAAGGG + Intergenic
1123736720 15:23191677-23191699 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124287421 15:28414652-28414674 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124287945 15:28420355-28420377 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124295281 15:28496972-28496994 CTGCTGTCCCAGTGGAAAAAGGG - Intergenic
1124608760 15:31193277-31193299 CTGCTTTCCCTCAGGAAAAATGG + Intergenic
1124621105 15:31274534-31274556 CAGCTGATGTTGAGGAAACATGG + Intergenic
1125244809 15:37622794-37622816 CTGCTATTCTTTAGGTAAATGGG + Intergenic
1125275242 15:37981965-37981987 CTACTGTTCATGAGGGAAACAGG - Intergenic
1126431880 15:48594474-48594496 CTGCTCCCCTTCAGGAAAAAGGG - Intronic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1127235587 15:57047696-57047718 CTGATATTCAAGAGGAAAAAAGG - Intronic
1127607028 15:60596692-60596714 CTGCTGTTTATGAGTATAAAGGG + Intronic
1128286022 15:66437863-66437885 CTGCTCTCATTGAGGAAAGAAGG - Intronic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1129996005 15:80006821-80006843 CTGCTGTGCTCCAGGACAAATGG - Intergenic
1130192595 15:81750751-81750773 CTGCTGTTTTTGCAGAACAAGGG - Intergenic
1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG + Intronic
1137330666 16:47492408-47492430 CTGCTGATCTGGTGGAGAAAAGG + Intronic
1139988714 16:70921500-70921522 CTGCTGTTCTGCAGGATCAAGGG + Intronic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143763784 17:9124153-9124175 CTGCTGATTTTTAAGAAAAATGG - Intronic
1143932314 17:10442061-10442083 CTCCTTTTCTGGAGCAAAAATGG + Intergenic
1143952181 17:10641969-10641991 CTGGTGTCCTTTAGGAAAATTGG + Intronic
1144409950 17:14991206-14991228 CTCGGGGTCTTGAGGAAAAATGG - Intergenic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1146636972 17:34513734-34513756 CTACTGTTCTTGTGTATAAATGG + Intergenic
1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG + Intronic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1156892156 18:42203344-42203366 CTGCTGATCTTGTGGGAAACTGG + Intergenic
1157124487 18:44943172-44943194 CTCCTGTTCATGAGCATAAATGG + Intronic
1157238271 18:45984357-45984379 CTGCTGTTTGTGAGTGAAAAAGG + Exonic
1157541003 18:48506571-48506593 TTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1162522589 19:11190712-11190734 CAGCTGTTCTTCTGGAAACATGG - Intronic
1164398221 19:27884762-27884784 GTGCTGTTACTGAGGATAAAGGG - Intergenic
1164453351 19:28385839-28385861 CTGCTGTTCTTGAATAAACATGG - Intergenic
1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG + Intergenic
1165014907 19:32873785-32873807 CTGCTGATTTTGGGGAAAGAGGG + Intergenic
1166268973 19:41701890-41701912 CTCCTGTTAATGAGCAAAAAGGG + Intronic
925517007 2:4693715-4693737 CTGCTGGTCTTGGGGAATTAGGG + Intergenic
925591405 2:5513411-5513433 CAGCTTTTCCTGAGGAAGAAGGG + Intergenic
926861964 2:17319244-17319266 CTTCTGCTCTTTAGGAATAAGGG - Intergenic
926897432 2:17709629-17709651 GTGCTGTTCCAGAGGATAAAGGG + Intronic
929516781 2:42610550-42610572 TGGCAGTTGTTGAGGAAAAACGG + Intronic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
930278869 2:49345798-49345820 CTGTTGTTCTTCTGGAACAACGG + Intergenic
930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
933914610 2:86976590-86976612 TTCTTGTTCTTCAGGAAAAACGG - Exonic
934008383 2:87793309-87793331 TTCTTGTTCTTCAGGAAAAACGG + Exonic
934313571 2:91894325-91894347 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
934667259 2:96181158-96181180 CTACTGTTCTAGATGAAAAGTGG + Intergenic
935468098 2:103423501-103423523 ATGCTATTTTTGGGGAAAAAAGG + Intergenic
935704079 2:105840838-105840860 CAGCTGTTCATTAGGAAAAGGGG - Intronic
938681499 2:133696387-133696409 CTGTTTTTCTCAAGGAAAAAGGG + Intergenic
938718545 2:134043608-134043630 CTGCTGATACTGAGGCAAAAAGG + Intergenic
941979979 2:171444729-171444751 TGGCTGTCCTTTAGGAAAAACGG + Intronic
942108996 2:172661401-172661423 CTGCTGTTCTTGAGGTTATTTGG + Intergenic
944282033 2:197909340-197909362 CTTCTGTTCCTTAGCAAAAAAGG - Intronic
1169461191 20:5797141-5797163 CTACTCTTCTTGATGAAATAAGG + Intronic
1169759220 20:9073308-9073330 CTCCTGTTCTAGAGAAGAAAGGG - Intronic
1171090449 20:22280607-22280629 CTGCTGTTGTTGTGGGAAAGTGG - Intergenic
1171211766 20:23322263-23322285 GTTCTGTTCCTAAGGAAAAAGGG + Intergenic
1172925069 20:38526483-38526505 CTGATGTGTTTGAGAAAAAAAGG - Intronic
1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG + Intronic
1175973968 20:62701154-62701176 CTGATGTTTTGGAGGAAACAGGG - Intergenic
1177935362 21:27338529-27338551 CTGATGTCCTTCAGAAAAAAAGG + Intergenic
1178055809 21:28797223-28797245 CTCCTGTTCTGAAGGAACAAAGG + Intergenic
1180540311 22:16440229-16440251 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1180645388 22:17334382-17334404 CTCCTGTTGTTGATGACAAACGG - Intergenic
1181879112 22:25963495-25963517 CTGGTGTCCTTGAGGACACATGG - Intronic
1182981358 22:34674435-34674457 CTGCTGTTCTTCTAAAAAAATGG - Intergenic
949521415 3:4858021-4858043 ATGCTGTTCTAGAAGAAAACAGG - Intronic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
950031798 3:9858652-9858674 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
950065959 3:10111938-10111960 ATGCTGTTCTTGAGTGAAGATGG - Intergenic
950417125 3:12875152-12875174 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
955314874 3:57929483-57929505 TTTCTATTCTTGAGGAAAACTGG - Intergenic
955701949 3:61690367-61690389 CTGCTTTTCTCCAGGATAAATGG + Intronic
961424842 3:126836908-126836930 CTGCTCTTCCTGAGGAGAAATGG + Intronic
961783848 3:129337655-129337677 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
962073940 3:132060691-132060713 CTGCTGAGGTTGTGGAAAAAAGG - Intronic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
964117273 3:153149320-153149342 GTGCTGTTCGTGAGGAATTAAGG - Intergenic
964670065 3:159215156-159215178 ATGCTGGGCTTGATGAAAAATGG + Intronic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
965436949 3:168664057-168664079 CTGCTGTTCTTGATGAGACTTGG + Intergenic
966373119 3:179268850-179268872 CTGCTTTTCCAGAGTAAAAAGGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968402600 4:311589-311611 TTTGTGTTCTTGAGGACAAAGGG + Intergenic
970743585 4:19267166-19267188 CTGCTTTACCTCAGGAAAAAAGG - Intergenic
971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG + Intergenic
971752816 4:30673117-30673139 TTGCTATTCTTTAGGAAAATTGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
973804436 4:54512197-54512219 TTGGTGTTCAGGAGGAAAAAAGG + Intergenic
973897566 4:55430090-55430112 CTGGGGTTCTTGAATAAAAATGG - Exonic
975321663 4:73015416-73015438 CTGGTGTTCTGGAGGAAGAGTGG - Intergenic
975578751 4:75888366-75888388 CTGATATTCGTGAGGGAAAATGG + Intronic
975788221 4:77917675-77917697 GTATTTTTCTTGAGGAAAAAAGG - Intronic
975829964 4:78358889-78358911 CTGATGATATTGAGTAAAAAAGG + Intronic
976106955 4:81629519-81629541 GTGAGGTTCTTGAGGACAAAGGG - Intronic
976311801 4:83620542-83620564 CTGGTGTTCTTGTAAAAAAAAGG - Intergenic
976350195 4:84051982-84052004 CCGTTGTTCCTTAGGAAAAAAGG + Intergenic
976962973 4:91002365-91002387 CTGGTATTCCTGAGGAAGAAGGG - Intronic
977211835 4:94227187-94227209 CTGGTGTTTTTGAGGAAAGTGGG + Intronic
977945773 4:102912376-102912398 CTGCTTTTGGTGAAGAAAAAAGG + Intronic
979817069 4:125121825-125121847 CAGCTGTTCTGGAAAAAAAAAGG + Intergenic
981510917 4:145557533-145557555 TTGCTGGTCTTGAGGAATGAAGG - Intronic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
982497825 4:156113115-156113137 CTGCTGTTTTTGACCAAAAGTGG + Intergenic
982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG + Intergenic
983241161 4:165234823-165234845 CTACTTTTATTGAGAAAAAAAGG - Intronic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
984988494 4:185354354-185354376 CTACTGCTCAAGAGGAAAAAAGG - Intronic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
986289206 5:6385312-6385334 CTGCTGGTCTTGAGCAGAGAAGG - Intergenic
986317614 5:6601077-6601099 CTGCTTTACATTAGGAAAAATGG - Intronic
988617315 5:32787460-32787482 AAGTTGTTCTTGAGGGAAAAGGG - Exonic
990387014 5:55274946-55274968 CTGCTGTACTTTTGGTAAAATGG + Exonic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
993134868 5:83947292-83947314 CTGCTGTTCTTAAGGGATAGAGG + Intronic
994827807 5:104738124-104738146 ATGCTATTTTTGAGGGAAAATGG + Intergenic
996201468 5:120679995-120680017 CTGCTCTTGTTGGGGAGAAATGG + Intronic
996307082 5:122059655-122059677 CTGCAGTTCTTGAAGAACATGGG + Intronic
996427345 5:123329258-123329280 TTGGTGTTCCTGAGGAAGAAGGG - Intergenic
996729968 5:126707460-126707482 CTGCAGTAATTGGGGAAAAAAGG + Intergenic
997177238 5:131792135-131792157 CTGCTGTTCATGATGATAACTGG + Intronic
997669768 5:135661184-135661206 CTGCTGTTCTGGAGGCAGACAGG - Intergenic
998788871 5:145744236-145744258 CTGCTGGTCTGCAGGAGAAAAGG - Intronic
999583251 5:153062827-153062849 CTGCTTTTCTTAAGCAAAAATGG - Intergenic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1002845485 6:940866-940888 CTGCTTCTCGTGAGGAAAACAGG + Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1003894733 6:10596553-10596575 CCGTTTTTCTGGAGGAAAAATGG + Intronic
1004049071 6:12056317-12056339 ATGATGTTCTTAAGGAAAAGTGG + Intronic
1004405230 6:15326986-15327008 TTGTTGTTCTTGAGGAAATGAGG + Intronic
1005361657 6:25036802-25036824 CTCCTGTTCTTCTGGGAAAATGG - Intronic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1007291519 6:40790890-40790912 CTGCTGTTGTGGAGGGTAAATGG - Intergenic
1007814583 6:44512141-44512163 CTACTGGTTTTGAGGATAAATGG + Intergenic
1007983285 6:46180826-46180848 CTGCTTTTCTTGAGGGGAGAGGG + Intergenic
1008182826 6:48354223-48354245 TTGATGTTTTTGAGGAACAATGG + Intergenic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1008865207 6:56202270-56202292 TTGTTTTTCTGGAGGAAAAAGGG + Intronic
1012429860 6:99153055-99153077 CTGCTGGCCTTGAAGAAACAAGG + Intergenic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1016176069 6:141078881-141078903 TTGGTGTTCCTGAGGAATAATGG + Intergenic
1016887191 6:148969662-148969684 CTCCAGGTCTGGAGGAAAAATGG - Intronic
1021548400 7:21842387-21842409 CTGCTGTACTTTAGGAAATTTGG + Intronic
1023100314 7:36711381-36711403 ATGCTGTGCTTCAGGAACAAAGG - Intronic
1023652912 7:42389747-42389769 CTACTGTACTAGAGGAAAGATGG - Intergenic
1023735516 7:43232614-43232636 ATGATGTTCTTGCGGGAAAAGGG + Intronic
1024448595 7:49512360-49512382 CTGCTGGCCTTGAAGAAATAAGG - Intergenic
1024537380 7:50449589-50449611 ATTCTGTTCTTGATGCAAAACGG + Exonic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1025724946 7:64047810-64047832 GTGCTGGTATTGAGGGAAAAAGG + Intronic
1027435257 7:78157862-78157884 CAGCTTTTCATGAAGAAAAAGGG + Intronic
1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG + Intronic
1028471717 7:91213191-91213213 CAGCCTTTCTTGAGGAAGAAAGG - Intergenic
1028646128 7:93098679-93098701 CTGCTGGCATTGAGGAAATAAGG + Intergenic
1029107137 7:98187207-98187229 CTGCTTTTCTAAAGGAAAATGGG - Intronic
1030197996 7:106871528-106871550 CTTCCGTTCCTTAGGAAAAAAGG + Intronic
1031570697 7:123355839-123355861 AGGCTGTTCGTGAGCAAAAAAGG + Intergenic
1031845619 7:126802710-126802732 CTGCAGCTCTTAAGGAAAATAGG - Intronic
1032592603 7:133206026-133206048 CTTCTGTTTTAGAGGAAAAGTGG + Intergenic
1032801942 7:135323965-135323987 CTGCTGTTCCTCAGGAAAGAAGG + Intergenic
1034637199 7:152576821-152576843 CTCCTGCCCTTAAGGAAAAAGGG + Intergenic
1036024769 8:4893858-4893880 TTTCTGTTTTTGGGGAAAAAAGG - Intronic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1037405493 8:18538071-18538093 ATGCTGCACCTGAGGAAAAATGG + Intronic
1039262031 8:35782237-35782259 TTACTGCTCTTGAGGATAAATGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG + Exonic
1042422766 8:68611354-68611376 CTGCATTTCTTTTGGAAAAAGGG + Intronic
1042659938 8:71143152-71143174 TTGCTGGTCTTGAGGTAGAAAGG - Intergenic
1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG + Intergenic
1043541787 8:81271650-81271672 ATGGTTTTCTTGAGGAACAAGGG + Intergenic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1044078613 8:87856070-87856092 CCTCTGTTCTTGGGGAAAACAGG - Intergenic
1044301006 8:90582806-90582828 CAGCTGTTGATGAGGGAAAAAGG - Intergenic
1045499889 8:102737161-102737183 TTACTGTTCTGGAGGACAAAAGG + Intergenic
1048383757 8:133892326-133892348 CATCTGTTGTTGGGGAAAAAAGG + Intergenic
1048525614 8:135199712-135199734 CTGCTCTTCTTTAGGAAATTAGG - Intergenic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG + Intronic
1049802442 8:144524291-144524313 CAGCAGATCGTGAGGAAAAAGGG + Exonic
1050302987 9:4277625-4277647 CTGCTGTCCTTGGAGACAAAGGG - Intronic
1050401593 9:5261953-5261975 CTGGGGTTCGTGAGGAAAACAGG + Intergenic
1051210939 9:14742572-14742594 TTGCTGTCCTTGTGGAAATATGG + Intronic
1051351442 9:16201508-16201530 ATGTTGTTCCTGATGAAAAAAGG - Intergenic
1051957235 9:22711239-22711261 ATTCTGTTCTGGAGGAAACAAGG - Intergenic
1053231609 9:36415156-36415178 TTGGTGTTGTTGAGGAAGAAGGG - Intronic
1053598337 9:39585755-39585777 CTGCTGATGTTCAGGATAAAGGG - Intergenic
1053856370 9:42342764-42342786 CTGCTGATGTTCAGGATAAAGGG - Intergenic
1055285555 9:74724792-74724814 CTACTGTTCATGAAGACAAATGG + Intronic
1055636869 9:78287588-78287610 CTGCTTTTCATGAGAAAACAAGG + Intergenic
1057791939 9:98130437-98130459 CTTCTGTCTTAGAGGAAAAAGGG - Intronic
1059003815 9:110379672-110379694 CTGCTGCTGTTGAGAAAAATTGG + Intronic
1060944490 9:127561916-127561938 CTTCTGTGCTGGAGGAAGAAGGG - Intronic
1061626879 9:131845799-131845821 CTGCTTTTCTTGACTAAAGATGG + Intergenic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1187742741 X:22373899-22373921 TTCCTGTTCTTGAGTAAACATGG - Intergenic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1191669781 X:63738545-63738567 ATGCGGTGCTTCAGGAAAAATGG - Intronic
1193165692 X:78277550-78277572 CTGCTGTGCTGGAGGAACCAAGG - Intronic
1193446770 X:81615397-81615419 TTGATGTTCCTGAGGAAGAAGGG - Intergenic
1194292356 X:92089973-92089995 ATGATCATCTTGAGGAAAAATGG - Intronic
1195432311 X:104803082-104803104 CTGCTGTTGGGGAGGAAGAAAGG + Intronic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1195827479 X:109018022-109018044 GTGATGGTCTTAAGGAAAAAGGG - Intergenic
1195933261 X:110100952-110100974 CTGTTGTTCATGAGGAATATTGG + Intronic
1196161456 X:112488515-112488537 TTGTTGTTCCTGAGGAAGAAGGG + Intergenic
1196676069 X:118421149-118421171 CTGCTTTGCTTTAGGGAAAAGGG + Intronic
1198314016 X:135448985-135449007 TTGTTGTTTTGGAGGAAAAAAGG - Intergenic
1199868459 X:151875323-151875345 CTGCTGTTCTTGGGCAAGCAAGG - Intergenic
1200609864 Y:5314599-5314621 ATGATCATCTTGAGGAAAAATGG - Intronic
1201181486 Y:11351816-11351838 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic