ID: 917327862

View in Genome Browser
Species Human (GRCh38)
Location 1:173851567-173851589
Sequence TGATGAGTGCCATCATGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917327859_917327862 6 Left 917327859 1:173851538-173851560 CCTTTTTCCTCAAGAACAGCAGC 0: 1
1: 0
2: 0
3: 18
4: 251
Right 917327862 1:173851567-173851589 TGATGAGTGCCATCATGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 119
917327861_917327862 -1 Left 917327861 1:173851545-173851567 CCTCAAGAACAGCAGCTGTAGGT 0: 1
1: 0
2: 2
3: 13
4: 133
Right 917327862 1:173851567-173851589 TGATGAGTGCCATCATGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 119
917327857_917327862 27 Left 917327857 1:173851517-173851539 CCAACTTGGTCAAAGTGGGACCC 0: 1
1: 0
2: 0
3: 4
4: 86
Right 917327862 1:173851567-173851589 TGATGAGTGCCATCATGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 119
917327858_917327862 7 Left 917327858 1:173851537-173851559 CCCTTTTTCCTCAAGAACAGCAG 0: 1
1: 0
2: 2
3: 35
4: 296
Right 917327862 1:173851567-173851589 TGATGAGTGCCATCATGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917327862 Original CRISPR TGATGAGTGCCATCATGCAC TGG Intronic
900492792 1:2960988-2961010 TCCTGTGTGCCAGCATGCACAGG - Intergenic
901832677 1:11902770-11902792 AGATGTGTGCCATCATGCCTGGG - Intergenic
902868466 1:19296914-19296936 TTGTGAGTGCAATGATGCACTGG - Intergenic
906687363 1:47771328-47771350 TGGTGAGTTCCACCATGCAGGGG - Intronic
907984088 1:59513873-59513895 TGATGAGAGCGATCCTGCTCTGG - Intronic
917327862 1:173851567-173851589 TGATGAGTGCCATCATGCACTGG + Intronic
921031496 1:211338766-211338788 AGATGTGTGCCACCATGCCCAGG + Intronic
922712553 1:227844799-227844821 TGAGGAGTCCCACCATACACAGG - Intronic
1064596965 10:16955090-16955112 AGATGTGAGCCACCATGCACGGG - Intronic
1064967625 10:21030869-21030891 TGGTGAGTGCCATGATGTACAGG - Intronic
1075232834 10:120698495-120698517 AGATGTGTGCCACCATGCCCAGG + Intergenic
1077786055 11:5384542-5384564 TGATGAGTGCCTGCATGGCCAGG + Intronic
1078447906 11:11418585-11418607 TGCTGAGTGCCATGAGCCACAGG - Intronic
1078553074 11:12293764-12293786 TGATGAGTGCCAGCCAGCAGAGG + Exonic
1084584125 11:70046286-70046308 TGGTGTGTGCCATCTTGCCCTGG - Intergenic
1085486366 11:76866933-76866955 TGATGTGAGCCATCATGCCCAGG + Intronic
1089064304 11:115650677-115650699 AGATGTGTGCCAGGATGCACTGG - Intergenic
1089451653 11:118602263-118602285 TTTTGAGTGTCATCATGTACTGG + Exonic
1090067743 11:123518082-123518104 TGATGAGTGACTTCAGGCAACGG + Intergenic
1091346559 11:134858066-134858088 TGATGAGTGCCACCTTCCATGGG + Intergenic
1095046286 12:37510779-37510801 TGATGAGTCCAATCAGGCACTGG - Intergenic
1098211636 12:68172369-68172391 TGATGTGTGCCATCCTCCATGGG + Intergenic
1098974427 12:76887565-76887587 AGGTGTGTGCCATCATGCCCGGG - Intergenic
1102184652 12:110938220-110938242 AGATGTGTGCCACCATGCCCAGG + Intergenic
1103743438 12:123106770-123106792 GGCTGAGTGCCCTCATGCCCTGG - Intronic
1104517438 12:129441008-129441030 TGATGAGTGCTTTGATGCATTGG + Intronic
1107628425 13:42316309-42316331 TGATGTCTGCCAGCATGCCCTGG + Intronic
1109078774 13:57871104-57871126 TTATGAGTGAGAGCATGCACTGG - Intergenic
1110399301 13:75071129-75071151 TGCTCTGTCCCATCATGCACAGG + Intergenic
1112321817 13:98414864-98414886 TGATGGGAGCCATCATGCTTTGG - Intronic
1113662183 13:112115100-112115122 TGATGAGTGCCATGAGTCAGGGG + Intergenic
1114595620 14:23909306-23909328 TGAAGAGAGCCATCATGCCCAGG - Intergenic
1117606913 14:57439762-57439784 TGATGAGTTCCCTCAAGCTCTGG + Intergenic
1121690033 14:95871593-95871615 TGAAGAGTGACATAAAGCACAGG - Intergenic
1123754516 15:23386487-23386509 TGATGAGTGTCAACATCAACAGG - Intergenic
1124345149 15:28917307-28917329 TGGTGAGGGCCATCAGGCTCTGG - Intronic
1125927655 15:43576482-43576504 TGAAGAGTGCCAACATGAATGGG - Exonic
1125940798 15:43676047-43676069 TGAAGAGTGCCAACATGAATGGG - Intergenic
1126288818 15:47047759-47047781 CGATGAGTCCAATCAGGCACTGG + Intergenic
1129886782 15:79043733-79043755 AGATGAGTGGCATCCTCCACAGG - Intronic
1130058008 15:80545723-80545745 TAATGAGTCCCATCATTCAAAGG + Intronic
1130563056 15:84973667-84973689 TGATGAGTGCTGTGATGTACAGG - Intergenic
1132287158 15:100671534-100671556 TGATGGGTGTCAACAGGCACTGG + Intergenic
1132696229 16:1203125-1203147 TGCTGTGTGCCCTCATGCGCTGG + Intronic
1137645113 16:50066626-50066648 TTCTGTGTGCCATCAGGCACTGG + Intronic
1138959033 16:62007049-62007071 AGGTGAGTGCCACCATGCCCGGG + Intronic
1140330953 16:74056373-74056395 TGATGAGTGACCTCATCAACAGG + Intergenic
1141827166 16:86488666-86488688 TGATGAGTATCCTCATACACAGG + Intergenic
1146643045 17:34555484-34555506 TGATGTGTAGCATCATCCACTGG - Intergenic
1147123126 17:38347830-38347852 AGGTGCGTGCCATCATGCCCAGG + Intergenic
1151157895 17:72139657-72139679 AGATGAGTGCAATGTTGCACAGG - Intergenic
1152929562 17:83102930-83102952 AGTTGAGGGCCATCATGCATGGG - Intergenic
1155728314 18:29117922-29117944 TGATGATTGCCATCATGTTATGG + Intergenic
925448842 2:3951514-3951536 TGAGGGGTACCATCCTGCACAGG - Intergenic
926143148 2:10380514-10380536 TGCTGACTGCCATCACCCACTGG + Intronic
927003650 2:18825538-18825560 ACGTGTGTGCCATCATGCACAGG - Intergenic
927274578 2:21251664-21251686 TGGTGAGTGCCACCAAGCATGGG + Intergenic
927939323 2:27093836-27093858 TACTGAGTGGCATCAGGCACGGG + Intronic
934605011 2:95688008-95688030 TGATTTGTAACATCATGCACTGG - Intergenic
935638582 2:105269656-105269678 TGGAGAGCGCCATCCTGCACGGG - Exonic
938045243 2:128112810-128112832 TGATTACAGGCATCATGCACTGG + Intronic
938713763 2:133999856-133999878 TGATTAATGCCATTATCCACTGG - Intergenic
938838417 2:135132476-135132498 TGAAGAGTTACATCATCCACAGG - Intronic
939585499 2:143999357-143999379 TGATGACTACCATCATGGAAAGG + Intronic
940326703 2:152433206-152433228 TGCTGTGTGCCATCAAGCAGAGG + Intronic
942207065 2:173629761-173629783 TGGTAAGTGCCCACATGCACAGG + Intergenic
942923791 2:181409369-181409391 TGATGAGTGACCTCATGCGGAGG - Intergenic
945197669 2:207252169-207252191 TGCTGAGTGTCACCATGCAATGG - Intergenic
946842696 2:223834444-223834466 AGGTGTGTGCCATCATGCCCAGG - Intronic
947060175 2:226155524-226155546 AGATGAGTGCCCCAATGCACAGG + Intergenic
948219228 2:236256167-236256189 AGGTGTGTGCCATCATGCCCAGG + Intronic
948995076 2:241573896-241573918 TCCTGAGTGCCATGCTGCACTGG - Exonic
1170155245 20:13263196-13263218 GAATGATTGCCATCATACACAGG + Intronic
1171540850 20:25954377-25954399 TGATGAGTCCAGTCAGGCACTGG - Intergenic
1171800213 20:29605933-29605955 TGATGAGTCCAGTCAGGCACTGG + Intergenic
1175127031 20:56760075-56760097 TGATGAGTGCCCTGACGCCCAGG - Intergenic
1176264069 20:64199437-64199459 TGATGGCTGCCAAGATGCACGGG - Intronic
1177664572 21:24137931-24137953 TTATGTTTGCCATCATGCATAGG - Intergenic
1179281217 21:39935940-39935962 TAATAAGTGCCATCAGGAACAGG - Intergenic
1182580792 22:31309547-31309569 AGGTGAGTGCCACCATGCCCAGG + Intergenic
1185084324 22:48730728-48730750 TGAAGTGTGCCATCTTACACGGG - Intronic
951444628 3:22764361-22764383 TGATCACTGCCAACAAGCACAGG + Intergenic
956528985 3:70196599-70196621 TGATGAGTGCAATAACGCAGTGG + Intergenic
956712775 3:72052611-72052633 AGATGTGTGCCACCATGCCCAGG - Intergenic
974421998 4:61688627-61688649 TAATCAGTGCTATCAGGCACTGG + Intronic
976812138 4:89109364-89109386 AGGTGCGTGCCATCATGCCCAGG - Intronic
977709012 4:100103197-100103219 AGATCAGTGACAGCATGCACAGG - Intergenic
986027433 5:3864154-3864176 GGATGAGCGCCATCAGGCTCTGG - Intergenic
986166980 5:5281997-5282019 TGATGAGTGTGATAATGCATTGG + Intronic
992816177 5:80441780-80441802 TTATGAGTGCCATCATTCAGTGG + Intronic
995519335 5:112986857-112986879 AGGTGAGTGCCACCATGCCCAGG - Intronic
995943544 5:117613669-117613691 TGATGAGGGTCAGCATGCATGGG + Intergenic
999004571 5:147961713-147961735 TGATTAGTGCCATGTTGCACTGG - Intergenic
1000027098 5:157368790-157368812 TGAACAGTGCCATCATGGATGGG - Intronic
1000242827 5:159424485-159424507 TCTTGAGTGGCATCTTGCACAGG - Intergenic
1000839721 5:166203054-166203076 TGGTGTGTGCCACCATGCCCTGG + Intergenic
1005148600 6:22721763-22721785 TGATGGGAGCCATCAGGCAGGGG - Intergenic
1009435257 6:63610470-63610492 TGGTGCGTGCCACCATGCCCTGG + Intergenic
1010099452 6:72086947-72086969 TAATGAGGGCCTTCATTCACAGG + Intronic
1010461682 6:76120794-76120816 TGATGAGTTCCCACATGAACAGG + Intergenic
1011322770 6:86115527-86115549 TGATGAGTTCCCTCAGGCTCTGG + Intergenic
1021314018 7:19123961-19123983 TGATGAGTGCCTTTGTGCATTGG + Intergenic
1022129048 7:27386980-27387002 TGATAAGTGCCATGAAGAACTGG - Intergenic
1023797859 7:43808674-43808696 TGCTGAGGGACATCATGCCCTGG + Intergenic
1023819264 7:43971362-43971384 AGGTGAGTGCCACCATGCCCAGG + Intergenic
1024637015 7:51299514-51299536 TGAGGAGTGCCAGCATGCTATGG - Intronic
1024862593 7:53862887-53862909 AGAAGAGTGCCACCATGCATAGG - Intergenic
1025292280 7:57740633-57740655 TGATGAGTCCAATCAGGCACTGG - Intergenic
1026861400 7:73792414-73792436 AGGTGTGTGCCACCATGCACTGG - Intergenic
1029744317 7:102508327-102508349 AGGTGAGTGCCACCATGCCCAGG + Intronic
1029762308 7:102607489-102607511 AGGTGAGTGCCACCATGCCCAGG + Intronic
1032137395 7:129292621-129292643 TGGTGTGTGCCACCATGCCCAGG - Intronic
1047583384 8:126241828-126241850 AGGTGCGTGCCATCATGCCCGGG - Intergenic
1049078302 8:140418980-140419002 TGTTGAGTGCCATCACGAAAGGG - Intronic
1051621849 9:19058329-19058351 AGAAGAGTGCCACCATGCATAGG + Exonic
1053573859 9:39337775-39337797 TGATGACTGCCATCTTACAGAGG + Intergenic
1053838481 9:42166332-42166354 TGATGACTGCCATCTTACAGAGG + Intergenic
1054095425 9:60896463-60896485 TGATGACTGCCATCTTACAGAGG + Intergenic
1054116887 9:61172383-61172405 TGATGACTGCCATCTTACAGAGG + Intergenic
1054164215 9:61705079-61705101 TGATGAGTTCAATCAGGCACTGG + Intergenic
1054590865 9:67010180-67010202 TGATGACTGCCATCTTACAGAGG - Intergenic
1055194679 9:73574432-73574454 TCATGACTGCAGTCATGCACAGG - Intergenic
1057880626 9:98790360-98790382 TGATGGCTGCCATCCAGCACGGG - Exonic
1185728790 X:2444690-2444712 AGGTGTGTGCCATCATGCCCAGG - Intronic
1187302481 X:18064518-18064540 TTATGTGTGCAAGCATGCACAGG + Intergenic
1187753397 X:22492869-22492891 GGATGGGGGCCATCATTCACTGG + Intergenic
1196300825 X:114048100-114048122 AGATGGGCGCCACCATGCACAGG - Intergenic
1197907368 X:131440421-131440443 TGATGAGGGCCTACATGCAGAGG - Intergenic